v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-33a URS0000483184_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-33a: Bta-mir-33a is a microRNA that has been identified in various studies as having potential regulatory functions in milk fat metabolism [PMC6731312] [PMC6699390] [PMC7744623] [PMC4783934]. It has been found to negatively regulate the expression of elongation of very long chain fatty acids protein 5 (ELOVL5), elongation of very long chain fatty acids protein 6 (ELOVL6), and sterol-C4-methyl oxidase (SC4MOL) in the mammary gland with low milk fat content [PMC6699390]. Bta-mir-33a is also predicted to target genes such as ELOVL5, ELOVL6, and SC4MOL, which are up-regulated in mammary gland with low milk fat content [PMC4783934]. Furthermore, bta-mir-33a has been found to be expressed at a significantly lower level in certain mammary gland tissues [PMC4783934]. It is worth noting that the regulatory function of bta-mir-33a may vary depending on the specific tissue, organ, and physiological conditions being studied [PMC4783934]. Bta-mir-33a has also been identified as one of the differentially expressed microRNAs between preadipocytes and adipocytes, suggesting its involvement in lipid metabolism [PMC7278844]. Additionally, bta-mir-33a has been found to regulate the expression of GHRHR (ENSBTAG00000047599) through its interaction with circRNAs and miRNAs such as bta-miR-218 [PMC9821774]. Overall, bta-mir-33a appears to play an important role in milk fat metabolism and lipid metabolism pathways.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUGCAUUGUAGUUGCAUUGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 59 other species

  1. Aedes aegypti aae-miR-33
  2. Alligator mississippiensis (American alligator) ami-miR-33-5p
  3. Anolis carolinensis aca-miR-33-5p
  4. Anopheles gambiae aga-miR-33-5p
  5. Blattella germanica (German cockroach) Bge-Mir-33_5p (mature (guide))
  6. Bombyx mori bmo-miR-33-5p
  7. Branchiostoma belcheri bbe-miR-33-5p
  8. Branchiostoma floridae (Florida lancelet) Bfl-Mir-33-P6_5p (mature (guide))
  9. Branchiostoma lanceolatum (amphioxus) Bla-Mir-33-P6_5p (mature (guide))
  10. Callorhinchus milii Cmi-Mir-33-P1_5p (mature (guide))
  11. Canis lupus familiaris Cfa-Mir-33-P3_5p (mature (guide))
  12. Capitella teleta cte-miR-33
  13. Cavia porcellus (domestic guinea pig) cpo-miR-33a-5p
  14. Centruroides sculpturatus Csc-Mir-33_5p (mature (guide))
  15. Chrysemys picta bellii Cpi-Mir-33-P1_5p (mature (co-guide))
  16. Chrysemys picta (Painted turtle) cpi-miR-33-5p
  17. Columba livia cli-miR-33-5p
  18. Crassostrea gigas Cgi-Mir-33_5p (mature (guide))
  19. Culex quinquefasciatus cqu-miR-33
  20. Dasypus novemcinctus dno-miR-33a-5p
  21. Dinoponera quadriceps dqu-miR-33-5p
  22. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-33-P3_5p (mature (guide))
  23. Eisenia fetida Efe-Mir-33_5p (mature (co-guide))
  24. Eptatretus burgeri (inshore hagfish) Ebu-Mir-33_5p (mature (guide))
  25. Equus caballus (horse) eca-miR-33a
  26. Gadus morhua gmo-miR-33b-5p
  27. Gallus gallus (chicken) Gga-Mir-33-P3_5p (mature (co-guide))
  28. Gekko japonicus Gja-Mir-33-P1_5p (mature (guide))
  29. Heliconius melpomene Hme-Mir-33-P8_5p (mature (guide))
  30. Homo sapiens hsa-miR-33a-5p
  31. Latimeria chalumnae Lch-Mir-33-P1_5p (mature (guide))
  32. Lepisosteus oculatus (spotted gar) Loc-Mir-33-P1_5p (mature (guide))
  33. Limulus polyphemus (Atlantic horseshoe crab) Lpo-Mir-33-P12_5p (mature (guide))
  34. Lottia gigantea (owl limpet) Lgi-Mir-33_5p (mature (guide))
  35. Macaca mulatta (Rhesus monkey) Mml-Mir-33-P3_5p (mature (guide))
  36. Manduca sexta mse-miR-33
  37. Microcaecilia unicolor Mun-Mir-33-P3_5p (mature (guide))
  38. Monodelphis domestica (gray short-tailed opossum) mdo-miR-33-5p
  39. Monopterus albus (swamp eel) Mal-Mir-33-P1b_5p (mature (co-guide))
  40. Mus musculus (house mouse) mmu-miR-33-5p
  41. Nautilus pompilius Npo-Mir-33_5p (mature (guide))
  42. Oreochromis niloticus oni-miR-33b-5p
  43. Ornithorhynchus anatinus Oan-Mir-33-P1_5p (mature (guide))
  44. Oryctolagus cuniculus (rabbit) ocu-miR-33a-5p
  45. Pteropus alecto (black flying fox) pal-miR-33a-5p
  46. Ptychodera flava Pfl-Mir-33_5p (mature (guide))
  47. Python bivittatus pbv-miR-33-5p
  48. Rattus norvegicus (Norway rat) rno-miR-33-5p
  49. Salmo salar (Atlantic salmon) ssa-miR-33a-5p
  50. Scyliorhinus torazame Sto-Mir-33-P1_5p (mature (guide))
  51. Sphenodon punctatus Spt-Mir-33-P3_5p (mature (guide))
  52. Taeniopygia guttata (zebra finch) Tgu-Mir-33-P1_5p (mature (guide))
  53. Tetraodon nigroviridis (spotted green pufferfish) Tni-Mir-33-P1b_5p (mature (guide))
  54. Tribolium castaneum Tca-Mir-33_5p (mature (guide))
  55. Triops cancriformis tcf-miR-33
  56. Tupaia chinensis tch-miR-33a-5p
  57. Xenopus laevis (African clawed frog) xla-miR-33a-5p
  58. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-33-P1_5p (mature (guide))
  59. Xenoturbella bocki Xbo-Mir-33_5p (mature (guide))
 Publications