Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (domestic cattle) bta-miR-103 URS0000476BE1_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-103: bta-mir-103 is a microRNA (miRNA) observed in cattle, with a role in various biological processes and molecular functions [PMC9569736]. It was found to be significantly more abundant in grazing cattle compared to those fed corn silage, suggesting a link to grazing-related factors such as diet and exercise [PMC9569736]. Despite a study indicating higher levels of bta-mir-103 in grain-fed cattle, this difference was not statistically significant [PMC9569736]. bta-mir-103 is involved in numerous pathways, including those related to cell differentiation in the mammary gland, potentially influencing milk production [PMC9569736]. Its expression is not affected by the mode of fresh grass delivery to the diet [PMC9569736], and it has been used as an endogenous control due to its stable expression across various conditions [PMC4839614]. Additionally, bta-mir-103 has been associated with responses to heat stress and sperm motility after cryopreservation [PMC9941329], indicating its multifaceted role in bovine physiology.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCAGCAUUGUACAGGGCUAUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 69 other species

  1. Alligator mississippiensis Ami-Mir-103-P2_3p (mature (guide))
  2. Anolis carolinensis (green anole) Aca-Mir-103-P2_3p (mature (guide))
  3. Ateles geoffroyi (black-handed spider monkey) age-miR-103
  4. Callithrix jacchus (white-tufted-ear marmoset) Cja-Mir-103-P2_3p (mature (guide))
  5. Callorhinchus milii (elephant shark) Cmi-Mir-103-P2_3p (mature (guide))
  6. Canis lupus familiaris (dog) cfa-miR-103
  7. Capra hircus chi-miR-103-3p
  8. Cavia porcellus (domestic guinea pig) cpo-miR-103-3p
  9. Cervus elaphus cel-miR-103
  10. Chiloscyllium plagiosum microRNA cpl-miR-103
  11. Chrysemys picta bellii (western painted turtle) Cpi-Mir-103-P2_3p (mature (guide))
  12. Columba livia cli-miR-103-3p
  13. Cricetulus griseus cgr-miR-103-3p
  14. Cyprinus carpio (common carp) ccr-miR-103
  15. Danio rerio (zebrafish) dre-miR-103
  16. Dasypus novemcinctus dno-miR-103a-3p
  17. Echinops telfairi Ete-Mir-103-P2_3p (mature (guide))
  18. Equus caballus eca-miR-103
  19. Gadus morhua (Atlantic cod) gmo-miR-103-3p
  20. Gallus gallus (chicken) gga-miR-103-3p
  21. Gekko japonicus Gja-Mir-103-P2_3p (mature (guide))
  22. Gorilla gorilla gorilla ggo-miR-103 (MIR103)
  23. Gorilla gorilla (western gorilla) ggo-miR-103
  24. Haplochromis burtoni abu-miR-103
  25. Homo sapiens hsa-miR-103a-3p
  26. Ictalurus punctatus ipu-miR-103
  27. Ictidomys tridecemlineatus (thirteen-lined ground squirrel) microRNA miR-103
  28. Lagothrix lagotricha lla-miR-103
  29. Latimeria chalumnae Lch-Mir-103-P2_3p (mature (guide))
  30. Lepisosteus oculatus (spotted gar) Loc-Mir-103-P2_3p (mature (guide))
  31. Macaca mulatta (Rhesus monkey) mml-miR-103-3p
  32. Macaca nemestrina mne-miR-103
  33. Maylandia zebra (zebra mbuna) mze-miR-103
  34. Microcaecilia unicolor Mun-Mir-103-P2_3p (mature (guide))
  35. Microcebus murinus mmr-miR-103a
  36. Monodelphis domestica (gray short-tailed opossum) mdo-miR-103-3p
  37. Monopterus albus (swamp eel) Mal-Mir-103-P2b_3p (mature (guide))
  38. Mus musculus mmu-miR-103-3p
  39. Neolamprologus brichardi (lyretail cichlid) nbr-miR-103
  40. Nomascus leucogenys nle-miR-103a
  41. Notamacropus eugenii (tammar wallaby) Neu-Mir-103-P2_3p (mature (guide))
  42. Ophiophagus hannah (king cobra) oha-miR-103b-3p
  43. Oreochromis niloticus oni-miR-103
  44. Ornithorhynchus anatinus oan-miR-103-3p
  45. Oryctolagus cuniculus ocu-miR-103a-3p
  46. Otolemur garnettii oga-miR-103a
  47. Ovis aries (sheep) miscellaneous RNA
  48. Pan paniscus ppa-miR-103
  49. Pan troglodytes (chimpanzee) ptr-miR-103
  50. Papio hamadryas pha-miR-103a
  51. Petromyzon marinus (sea lamprey) pma-miR-103b-3p
  52. Pongo abelii (Sumatran orangutan) Pab-Mir-103-P2_3p (mature (guide))
  53. Pongo pygmaeus (Bornean orangutan) ppy-miR-103
  54. Pteropus alecto (black flying fox) pal-miR-103b-3p
  55. Pundamilia nyererei pny-miR-103
  56. Python bivittatus (Burmese python) pbv-miR-103-3p
  57. Rattus norvegicus (Norway rat) rno-miR-103-3p
  58. Salmo salar (Atlantic salmon) ssa-miR-103-3p
  59. Sarcophilus harrisii Sha-Mir-103-P2_3p (mature (guide))
  60. Scyliorhinus torazame (cloudy catshark) Sto-Mir-103-P2_3p (mature (guide))
  61. Sphenodon punctatus Spt-Mir-103-P2_3p (mature (guide))
  62. Sus scrofa (pig) ssc-miR-103
  63. Taeniopygia guttata (zebra finch) tgu-miR-103-3p
  64. Takifugu rubripes (torafugu) fru-miR-107
  65. Tetraodon nigroviridis tni-miR-103
  66. Tor tambroides (Thai mahseer) miR-103
  67. Tupaia chinensis tch-miR-103a-3p
  68. Xenopus laevis (African clawed frog) xla-miR-103a-3p
  69. Xenopus tropicalis xtr-miR-103
Relationships

Molecular Relationships

Publications