Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (domestic cattle) bta-miR-103 URS0000476BE1_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-103: bta-mir-103 is a microRNA (miRNA) observed in cattle, with a role in various biological processes and molecular functions [PMC9569736]. It was found to be significantly more abundant in grazing cattle compared to those fed corn silage, suggesting a link to grazing-related factors such as diet and exercise [PMC9569736]. Despite a study indicating higher levels of bta-mir-103 in grain-fed cattle, this difference was not statistically significant [PMC9569736]. bta-mir-103 is involved in numerous pathways, including those related to cell differentiation in the mammary gland, potentially influencing milk production [PMC9569736]. Its expression is not affected by the mode of fresh grass delivery to the diet [PMC9569736], and it has been used as an endogenous control due to its stable expression across various conditions [PMC4839614]. Additionally, bta-mir-103 has been associated with responses to heat stress and sperm motility after cryopreservation [PMC9941329], indicating its multifaceted role in bovine physiology.

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCAGCAUUGUACAGGGCUAUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 69 other species

  1. Alligator mississippiensis Ami-Mir-103-P2_3p (mature (guide))
  2. Anolis carolinensis (green anole) Aca-Mir-103-P2_3p (mature (guide))
  3. Ateles geoffroyi age-miR-103
  4. Callithrix jacchus (white-tufted-ear marmoset) Cja-Mir-103-P2_3p (mature (guide))
  5. Callorhinchus milii (elephant shark) Cmi-Mir-103-P2_3p (mature (guide))
  6. Canis lupus familiaris (dog) cfa-miR-103
  7. Capra hircus (goat) chi-miR-103-3p
  8. Cavia porcellus (domestic guinea pig) cpo-miR-103-3p
  9. Cervus elaphus (red deer) cel-miR-103
  10. Chiloscyllium plagiosum microRNA cpl-miR-103
  11. Chrysemys picta bellii (western painted turtle) Cpi-Mir-103-P2_3p (mature (guide))
  12. Columba livia (rock pigeon) cli-miR-103-3p
  13. Cricetulus griseus (Chinese hamster) cgr-miR-103-3p
  14. Cyprinus carpio ccr-miR-103
  15. Danio rerio (zebrafish) dre-miR-103
  16. Dasypus novemcinctus dno-miR-103a-3p
  17. Echinops telfairi Ete-Mir-103-P2_3p (mature (guide))
  18. Equus caballus eca-miR-103
  19. Gadus morhua gmo-miR-103-3p
  20. Gallus gallus (chicken) gga-miR-103-3p
  21. Gekko japonicus Gja-Mir-103-P2_3p (mature (guide))
  22. Gorilla gorilla gorilla ggo-miR-103 (MIR103)
  23. Gorilla gorilla (western gorilla) ggo-miR-103
  24. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-103
  25. Homo sapiens (human) hsa-miR-103a-3p
  26. Ictalurus punctatus (channel catfish) ipu-miR-103
  27. Ictidomys tridecemlineatus microRNA miR-103
  28. Lagothrix lagotricha (brown woolly monkey) lla-miR-103
  29. Latimeria chalumnae (coelacanth) Lch-Mir-103-P2_3p (mature (guide))
  30. Lepisosteus oculatus Loc-Mir-103-P2_3p (mature (guide))
  31. Macaca mulatta mml-miR-103-3p
  32. Macaca nemestrina (pig-tailed macaque) mne-miR-103
  33. Maylandia zebra mze-miR-103
  34. Microcaecilia unicolor Mun-Mir-103-P2_3p (mature (guide))
  35. Microcebus murinus (gray mouse lemur) mmr-miR-103a
  36. Monodelphis domestica mdo-miR-103-3p
  37. Monopterus albus Mal-Mir-103-P2b_3p (mature (guide))
  38. Mus musculus mmu-miR-103-3p
  39. Neolamprologus brichardi (lyretail cichlid) nbr-miR-103
  40. Nomascus leucogenys nle-miR-103a
  41. Notamacropus eugenii (tammar wallaby) Neu-Mir-103-P2_3p (mature (guide))
  42. Ophiophagus hannah (king cobra) oha-miR-103b-3p
  43. Oreochromis niloticus (Nile tilapia) oni-miR-103
  44. Ornithorhynchus anatinus (platypus) oan-miR-103-3p
  45. Oryctolagus cuniculus (rabbit) ocu-miR-103a-3p
  46. Otolemur garnettii oga-miR-103a
  47. Ovis aries miscellaneous RNA
  48. Pan paniscus ppa-miR-103
  49. Pan troglodytes (chimpanzee) ptr-miR-103
  50. Papio hamadryas (hamadryas baboon) pha-miR-103a
  51. Petromyzon marinus pma-miR-103b-3p
  52. Pongo abelii (Sumatran orangutan) Pab-Mir-103-P2_3p (mature (guide))
  53. Pongo pygmaeus (Bornean orangutan) ppy-miR-103
  54. Pteropus alecto pal-miR-103a-3p
  55. Pundamilia nyererei pny-miR-103
  56. Python bivittatus (Burmese python) pbv-miR-103-3p
  57. Rattus norvegicus rno-miR-103-3p
  58. Salmo salar ssa-miR-103-3p
  59. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-103-P2_3p (mature (guide))
  60. Scyliorhinus torazame (cloudy catshark) Sto-Mir-103-P2_3p (mature (guide))
  61. Sphenodon punctatus (tuatara) Spt-Mir-103-P2_3p (mature (guide))
  62. Sus scrofa ssc-miR-103
  63. Taeniopygia guttata (zebra finch) tgu-miR-103-3p
  64. Takifugu rubripes (torafugu) fru-miR-107
  65. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-103
  66. Tor tambroides (Thai mahseer) miR-103
  67. Tupaia belangeri chinensis tch-miR-103a-3p
  68. Xenopus laevis xla-miR-103a-3p
  69. Xenopus tropicalis (tropical clawed frog) xtr-miR-103
Relationships

Molecular Relationships

Publications