v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-103 URS0000476BE1_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-miR-103: Bta-mir-103 is a microRNA that has been studied in various contexts. It has been found to be more abundant in grazing farms compared to corn silage farms, suggesting a potential association with factors intrinsic to grazing such as diet, fresh grass consumption, exercise, immune response, and oxidative status [PMC9569736]. Bta-mir-103 has also been implicated in cell differentiation in the mammary gland and the regulation of milk production [PMC9569736]. It has been observed that the levels of bta-mir-103 differ between different dairy production systems [PMC9569736]. However, there is conflicting evidence regarding the effect of fresh grass delivery mode on bta-mir-103 expression [PMC9569736]. Bta-mir-103 has also been associated with heat stress and sperm motility in cattle [PMC9941329]. Additionally, bta-mir-103 has been found to be highly expressed in various samples such as blood, PBMCs (peripheral blood mononuclear cells), and sperm [PMC4860563] [PMC4892552] [PMC7214931]. It is worth noting that there are different isomiRs (isoforms of miRNA) associated with bta-mir-103 expression patterns [PMC4517789]. Overall, bta-mir-103 appears to play a role in various biological processes and may have potential implications for animal health and production.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGCAGCAUUGUACAGGGCUAUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 66 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-103-P2_3p (mature (guide))
  2. Anolis carolinensis (green anole) Aca-Mir-103-P2_3p (mature (guide))
  3. Ateles geoffroyi age-miR-103
  4. Callorhinchus milii Cmi-Mir-103-P2_3p (mature (guide))
  5. Canis lupus familiaris (dog) cfa-miR-103
  6. Capra hircus (goat) chi-miR-103-3p
  7. Cavia porcellus (domestic guinea pig) cpo-miR-103-3p
  8. Cervus elaphus cel-miR-103
  9. Chiloscyllium plagiosum microRNA cpl-miR-103
  10. Chrysemys picta bellii (western painted turtle) Cpi-Mir-103-P2_3p (mature (guide))
  11. Columba livia (rock pigeon) cli-miR-103-3p
  12. Cricetulus griseus cgr-miR-103-3p
  13. Cyprinus carpio ccr-miR-103
  14. Danio rerio dre-miR-103
  15. Dasypus novemcinctus dno-miR-103a-3p
  16. Echinops telfairi Ete-Mir-103-P2_3p (mature (guide))
  17. Equus caballus eca-miR-107a
  18. Gadus morhua gmo-miR-103-3p
  19. Gallus gallus (chicken) gga-miR-103-3p
  20. Gekko japonicus Gja-Mir-103-P2_3p (mature (guide))
  21. Gorilla gorilla gorilla ggo-miR-103 (MIR103)
  22. Gorilla gorilla ggo-miR-103
  23. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-103
  24. Homo sapiens (human) hsa-miR-103a-3p
  25. Ictalurus punctatus ipu-miR-103
  26. Ictidomys tridecemlineatus microRNA miR-103
  27. Lagothrix lagotricha lla-miR-103
  28. Latimeria chalumnae (coelacanth) Lch-Mir-103-P2_3p (mature (guide))
  29. Lepisosteus oculatus (spotted gar) Loc-Mir-103-P2_3p (mature (guide))
  30. Macaca mulatta (Rhesus monkey) mml-miR-103-3p
  31. Macaca nemestrina (pig-tailed macaque) mne-miR-103
  32. Maylandia zebra mze-miR-103
  33. Microcaecilia unicolor Mun-Mir-103-P2_3p (mature (guide))
  34. Microcebus murinus (gray mouse lemur) mmr-miR-103b
  35. Monodelphis domestica mdo-miR-103-3p
  36. Monopterus albus Mal-Mir-103-P2b_3p (mature (guide))
  37. Mus musculus (house mouse) mmu-miR-103-3p
  38. Neolamprologus brichardi (lyretail cichlid) nbr-miR-103
  39. Nomascus leucogenys nle-miR-103a
  40. Ophiophagus hannah oha-miR-103a-3p
  41. Oreochromis niloticus oni-miR-103
  42. Ornithorhynchus anatinus (platypus) oan-miR-103-3p
  43. Oryctolagus cuniculus ocu-miR-103a-3p
  44. Otolemur garnettii oga-miR-103b
  45. Ovis aries (sheep) miscellaneous RNA
  46. Pan paniscus (pygmy chimpanzee) ppa-miR-103
  47. Pan troglodytes ptr-miR-103
  48. Papio hamadryas (hamadryas baboon) pha-miR-103b
  49. Petromyzon marinus pma-miR-103b-3p
  50. Pongo pygmaeus (Bornean orangutan) ppy-miR-103
  51. Pteropus alecto (black flying fox) pal-miR-103b-3p
  52. Pundamilia nyererei pny-miR-103
  53. Python bivittatus (Burmese python) pbv-miR-103-3p
  54. Rattus norvegicus rno-miR-103-3p
  55. Salmo salar (Atlantic salmon) ssa-miR-103-3p
  56. Sarcophilus harrisii Sha-Mir-103-P2_3p (mature (guide))
  57. Scyliorhinus torazame Sto-Mir-103-P2_3p (mature (guide))
  58. Sphenodon punctatus Spt-Mir-103-P2_3p (mature (guide))
  59. Sus scrofa ssc-miR-103
  60. Taeniopygia guttata (zebra finch) tgu-miR-103-3p
  61. Takifugu rubripes fru-miR-107
  62. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-103
  63. Tor tambroides miR-103
  64. Tupaia chinensis (Chinese tree shrew) tch-miR-103a-3p
  65. Xenopus laevis (African clawed frog) xla-miR-103a-3p
  66. Xenopus tropicalis xtr-miR-103
 Publications