Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-103 URS0000476BE1_9615

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

cfa-miR-103: Cfa-mir-103 is a microRNA that has been studied in the context of congestive heart failure and cardiac enlargement in dogs. It has been found to be significantly differentially expressed between dogs with congestive heart failure and those with mild to moderate cardiac enlargement [PMC4964495]. In dogs with mitral valve disease (MMVD) and mild to moderate cardiac enlargement or congestive heart failure, cfa-mir-103 is one of the upregulated miRNAs [PMC4964495]. It has also been identified as a suitable reference for normalization in miRNA expression studies [PMC10093184]. In the context of MMVD, cfa-mir-103 is upregulated in stage B1/B2 or C/D compared to stage A, while other miRNAs such as cfa-miR-582 and cfa-miR-487b are downregulated [PMC4490541] [PMC9607079]. Cfa-mir-103 has predicted targets such as TβRII and TβRIII, suggesting its potential role in canine MMVD [PMC4490541]. Overall, cfa-mir-103 shows differential expression patterns in different stages of MMVD and may play a role in the progression of the disease.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCAGCAUUGUACAGGGCUAUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 66 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-103-P2_3p (mature (guide))
  2. Anolis carolinensis (green anole) Aca-Mir-103-P2_3p (mature (guide))
  3. Ateles geoffroyi age-miR-103
  4. Bos taurus bta-miR-103
  5. Callorhinchus milii Cmi-Mir-103-P2_3p (mature (guide))
  6. Capra hircus (goat) chi-miR-103-3p
  7. Cavia porcellus (domestic guinea pig) cpo-miR-103-3p
  8. Cervus elaphus cel-miR-103
  9. Chiloscyllium plagiosum microRNA cpl-miR-103
  10. Chrysemys picta bellii (western painted turtle) Cpi-Mir-103-P2_3p (mature (guide))
  11. Columba livia (rock pigeon) cli-miR-103-3p
  12. Cricetulus griseus cgr-miR-103-3p
  13. Cyprinus carpio ccr-miR-103
  14. Danio rerio dre-miR-103
  15. Dasypus novemcinctus dno-miR-103a-3p
  16. Echinops telfairi Ete-Mir-103-P2_3p (mature (guide))
  17. Equus caballus eca-miR-107a
  18. Gadus morhua gmo-miR-103-3p
  19. Gallus gallus (chicken) gga-miR-103-3p
  20. Gekko japonicus Gja-Mir-103-P2_3p (mature (guide))
  21. Gorilla gorilla gorilla ggo-miR-103 (MIR103)
  22. Gorilla gorilla ggo-miR-103
  23. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-103
  24. Homo sapiens (human) hsa-miR-103a-3p
  25. Ictalurus punctatus ipu-miR-103
  26. Ictidomys tridecemlineatus microRNA miR-103
  27. Lagothrix lagotricha lla-miR-103
  28. Latimeria chalumnae (coelacanth) Lch-Mir-103-P2_3p (mature (guide))
  29. Lepisosteus oculatus (spotted gar) Loc-Mir-103-P2_3p (mature (guide))
  30. Macaca mulatta (Rhesus monkey) mml-miR-103-3p
  31. Macaca nemestrina (pig-tailed macaque) mne-miR-103
  32. Maylandia zebra mze-miR-103
  33. Microcaecilia unicolor Mun-Mir-103-P2_3p (mature (guide))
  34. Microcebus murinus (gray mouse lemur) mmr-miR-103b
  35. Monodelphis domestica mdo-miR-103-3p
  36. Monopterus albus Mal-Mir-103-P2b_3p (mature (guide))
  37. Mus musculus (house mouse) mmu-miR-103-3p
  38. Neolamprologus brichardi (lyretail cichlid) nbr-miR-103
  39. Nomascus leucogenys nle-miR-103a
  40. Ophiophagus hannah oha-miR-103a-3p
  41. Oreochromis niloticus oni-miR-103
  42. Ornithorhynchus anatinus (platypus) oan-miR-103-3p
  43. Oryctolagus cuniculus ocu-miR-103a-3p
  44. Otolemur garnettii oga-miR-103b
  45. Ovis aries (sheep) miscellaneous RNA
  46. Pan paniscus (pygmy chimpanzee) ppa-miR-103
  47. Pan troglodytes ptr-miR-103
  48. Papio hamadryas (hamadryas baboon) pha-miR-103b
  49. Petromyzon marinus pma-miR-103b-3p
  50. Pongo pygmaeus (Bornean orangutan) ppy-miR-103
  51. Pteropus alecto (black flying fox) pal-miR-103b-3p
  52. Pundamilia nyererei pny-miR-103
  53. Python bivittatus (Burmese python) pbv-miR-103-3p
  54. Rattus norvegicus rno-miR-103-3p
  55. Salmo salar (Atlantic salmon) ssa-miR-103-3p
  56. Sarcophilus harrisii Sha-Mir-103-P2_3p (mature (guide))
  57. Scyliorhinus torazame Sto-Mir-103-P2_3p (mature (guide))
  58. Sphenodon punctatus Spt-Mir-103-P2_3p (mature (guide))
  59. Sus scrofa ssc-miR-103
  60. Taeniopygia guttata (zebra finch) tgu-miR-103-3p
  61. Takifugu rubripes fru-miR-107
  62. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-103
  63. Tor tambroides miR-103
  64. Tupaia chinensis (Chinese tree shrew) tch-miR-103a-3p
  65. Xenopus laevis (African clawed frog) xla-miR-103a-3p
  66. Xenopus tropicalis xtr-miR-103
Publications