Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-17-3p URS00004636A3_9823

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACUGCAGUGAAGGCACUUGUAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

  1. Anolis carolinensis aca-miR-17-3p
  2. Canis lupus familiaris (dog) cfa-miR-17
  3. Cavia porcellus cpo-miR-17-3p
  4. Dasypus novemcinctus dno-miR-17-3p
  5. Homo sapiens hsa-miR-17-3p
  6. Ophiophagus hannah (king cobra) oha-miR-17-3p
  7. Oryctolagus cuniculus (rabbit) ocu-miR-17-3p
  8. Taeniopygia guttata tgu-miR-17a-3p
  9. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-1683181
Publications