Dasypus novemcinctus (nine-banded armadillo) dno-miR-17-3p

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Dasypus novemcinctus (nine-banded armadillo) dno-miR-17-3p URS00004636A3_9361

22 nucleotides
1 database (miRBase)
Found in 9 other species

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

ACUGCAGUGAAGGCACUUGUAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

Anolis carolinensis aca-miR-17-3p
Canis lupus familiaris (dog) cfa-miR-17
Cavia porcellus cpo-miR-17-3p
Homo sapiens hsa-miR-17-3p
Ophiophagus hannah (king cobra) oha-miR-17-3p
Oryctolagus cuniculus (rabbit) ocu-miR-17-3p
Sus scrofa ssc-miR-17-3p
Taeniopygia guttata tgu-miR-17a-3p
Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-1683181