Canis lupus familiaris (dog) cfa-miR-17 URS00004636A3_9615

• 22 nucleotides
• 2 databases (miRBase, RefSeq)
• Found in 9 other species
• 254 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

ACUGCAGUGAAGGCACUUGUAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

1. Anolis carolinensis aca-miR-17-3p
2. Cavia porcellus cpo-miR-17-3p
3. Dasypus novemcinctus dno-miR-17-3p
4. Homo sapiens hsa-miR-17-3p
5. Ophiophagus hannah (king cobra) oha-miR-17-3p
6. Oryctolagus cuniculus (rabbit) ocu-miR-17-3p
7. Sus scrofa ssc-miR-17-3p
8. Taeniopygia guttata tgu-miR-17a-3p
9. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-1683181

Publications Download

• FASTA
• JSON