Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-106b URS00004449AE_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-106b: Bta-mir-106b is a microRNA that has been reported to be involved in various signaling pathways, including insulin, lipid, immune system, oxidative stress response, and muscle development. It is also associated with residual feed intake (RFI) in cattle [PMC9039951]. In a study using pmirGLO vectors carrying the 3′UTR sequence of CDKN1A, bta-mir-106b mimics and inhibitor were transferred into HEK293T cells [PMC9777812]. MicroRNAs are small non-coding RNA molecules that play important roles in gene regulation. Bta-mir-106b is one of the microRNAs that have been identified to have significant involvement in various signaling pathways. These pathways include insulin signaling, lipid metabolism, immune system regulation, oxidative stress response, and muscle development [PMC9039951]. Furthermore, bta-mir-106b has been found to be associated with residual feed intake (RFI) in cattle. RFI is a measure of feed efficiency and can impact the profitability of livestock production. The involvement of bta-mir-106b in RFI suggests its potential role in regulating energy metabolism and nutrient utilization [PMC9039951]. To further investigate the function of bta-mir-106b, a study utilized pmirGLO vectors carrying the 3′UTR sequence of CDKN1A (a gene involved in cell cycle regulation) and transferred them into HEK293T cells along with bta-mir-106b mimics and inhibitor. This experiment aimed to explore the regulatory effects of bta-mir-106b on CDKN1A expression [PMC9777812]. In conclusion, bta-mir-106b is a microRNA that plays important roles in various signaling pathways related to insulin signaling, lipid metabolism, immune system regulation oxidative stress response, and muscle development. It is also associated with residual feed intake in cattle. Further studies have investigated its regulatory effects on CDKN1A expression [PMC9039951] [PMC9777812].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAAAGUGCUGACAGUGCAGAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Ateles geoffroyi age-miR-106b
  2. Callithrix jacchus cja-miR-106b
  3. Canis lupus familiaris cfa-miR-106b
  4. Capra hircus (goat) chi-miR-106b-5p
  5. Equus caballus eca-miR-106b
  6. Gorilla gorilla gorilla ggo-miR-106b (MIR106B)
  7. Gorilla gorilla ggo-miR-106b
  8. Homo sapiens (human) hsa-miR-106b-5p
  9. Lagothrix lagotricha lla-miR-106b
  10. Macaca mulatta (Rhesus monkey) mml-miR-106b-5p
  11. Macaca nemestrina mne-miR-106b
  12. Mus musculus (house mouse) mmu-miR-106b-5p
  13. Ovis aries oar-miR-106b
  14. Pan paniscus (pygmy chimpanzee) ppa-miR-106b
  15. Pan troglodytes (chimpanzee) ptr-miR-106b
  16. Pongo pygmaeus ppy-miR-106b
  17. Rattus norvegicus rno-miR-106b-5p
  18. Saguinus labiatus (red-chested mustached tamarin) sla-miR-106b
Publications