Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ovis aries (sheep) oar-miR-106b URS00004449AE_9940

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAAAGUGCUGACAGUGCAGAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Ateles geoffroyi age-miR-106b
  2. Bos taurus bta-miR-106b
  3. Callithrix jacchus cja-miR-106b
  4. Canis lupus familiaris cfa-miR-106b
  5. Capra hircus (goat) chi-miR-106b-5p
  6. Equus caballus eca-miR-106b
  7. Gorilla gorilla gorilla ggo-miR-106b (MIR106B)
  8. Gorilla gorilla ggo-miR-106b
  9. Homo sapiens (human) hsa-miR-106b-5p
  10. Lagothrix lagotricha lla-miR-106b
  11. Macaca mulatta (Rhesus monkey) mml-miR-106b-5p
  12. Macaca nemestrina mne-miR-106b
  13. Mus musculus (house mouse) mmu-miR-106b-5p
  14. Pan paniscus (pygmy chimpanzee) ppa-miR-106b
  15. Pan troglodytes (chimpanzee) ptr-miR-106b
  16. Pongo pygmaeus ppy-miR-106b
  17. Rattus norvegicus rno-miR-106b-5p
  18. Saguinus labiatus (red-chested mustached tamarin) sla-miR-106b
Publications