Ateles geoffroyi (black-handed spider monkey) age-miR-106b URS00004449AE_9509

• 21 nucleotides
• 2 databases (ENA, miRBase)
• Found in 18 other species
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UAAAGUGCUGACAGUGCAGAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

1. Bos taurus bta-miR-106b
2. Callithrix jacchus cja-miR-106b
3. Canis lupus familiaris cfa-miR-106b
4. Capra hircus (goat) chi-miR-106b-5p
5. Equus caballus eca-miR-106b
6. Gorilla gorilla gorilla ggo-miR-106b (MIR106B)
7. Gorilla gorilla ggo-miR-106b
8. Homo sapiens (human) hsa-miR-106b-5p
9. Lagothrix lagotricha lla-miR-106b
10. Macaca mulatta (Rhesus monkey) mml-miR-106b-5p
11. Macaca nemestrina mne-miR-106b
12. Mus musculus (house mouse) mmu-miR-106b-5p
13. Ovis aries oar-miR-106b
14. Pan paniscus (pygmy chimpanzee) ppa-miR-106b
15. Pan troglodytes (chimpanzee) ptr-miR-106b
16. Pongo pygmaeus ppy-miR-106b
17. Rattus norvegicus rno-miR-106b-5p
18. Saguinus labiatus (red-chested mustached tamarin) sla-miR-106b

Download

• FASTA
• JSON