Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila innubila (Fruit fly) tRNA-Val secondary structure diagram

Drosophila innubila (Fruit fly) tRNA-Val URS000043A2BD_198719

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUUCCAUAGUGUAGCGGUUAUCACGUCUGCUUUACACGCAGAAGGUCUCCGGUUCGAUCCCGGAUGGAACCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 52 other species

  1. Coremacera marginata (Sieve-winged Snailkiller) misc RNA ENSCNRG00005015312.1
  2. Drosophila albomicans (Fruit fly) transfer RNA valine (anticodon UAC)
  3. Drosophila ananassae tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  4. Drosophila arizonae (Fruit fly) tRNA-Val
  5. Drosophila biarmipes (Fruit fly) transfer RNA valine (anticodon UAC)
  6. Drosophila bipectinata (Pomace flies) transfer RNA valine (anticodon UAC)
  7. Drosophila busckii (Fruit fly) tRNA-Val
  8. Drosophila elegans (Pomace flies) tRNA-Val
  9. Drosophila erecta tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  10. Drosophila eugracilis (Fruit fly) tRNA-Val
  11. Drosophila ficusphila (Fruit fly) tRNA-Val
  12. Drosophila grimshawi tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  13. Drosophila guanche (Fruit fly) tRNA-Val
  14. Drosophila gunungcola (Fruit fly) transfer RNA valine (anticodon UAC)
  15. Drosophila hydei (Fruit fly) tRNA-Val
  16. Drosophila kikkawai (Pomace flies) transfer RNA valine (anticodon UAC)
  17. Drosophila mauritiana (Fruit fly) tRNA-Val
  18. Drosophila melanogaster transfer RNA:Valine-TAC 1-1 (Dmel_CR32420, Dmel_CR32421)
  19. Drosophila miranda (Fruit fly) tRNA-Val
  20. Drosophila mojavensis tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  21. Drosophila montana (Pomace flies) transfer RNA valine (anticodon UAC)
  22. Drosophila nasuta (Pomace flies) transfer RNA valine (anticodon UAC)
  23. Drosophila navojoa (Fruit fly) tRNA-Val
  24. Drosophila novamexicana (Pomace flies) tRNA-Val
  25. Drosophila obscura (Fruit fly) tRNA-Val
  26. Drosophila persimilis tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  27. Drosophila pseudoobscura (Fruit fly) tRNA-Val
  28. Drosophila pseudoobscura pseudoobscura tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  29. Drosophila rhopaloa (Fruit fly) tRNA-Val
  30. Drosophila santomea (Fruit fly) tRNA-Val
  31. Drosophila sechellia tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  32. Drosophila serrata (Pomace flies) tRNA-Val
  33. Drosophila simulans tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  34. Drosophila subobscura (Fruit fly) tRNA-Val
  35. Drosophila subpulchrella (Fruit fly) tRNA-Val
  36. Drosophila sulfurigaster albostrigata (Flies) transfer RNA valine (anticodon UAC)
  37. Drosophila suzukii (Pomace flies) transfer RNA valine (anticodon UAC)
  38. Drosophila takahashii (Pomace flies) transfer RNA valine (anticodon UAC)
  39. Drosophila teissieri (Fruit fly) tRNA-Val
  40. Drosophila tropicalis (Pomace flies) transfer RNA valine (anticodon UAC)
  41. Drosophila virilis tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  42. Drosophila willistoni tRNA-Val (TAC) (tRNA-Val-TAC-1 1 to 4)
  43. Drosophila yakuba tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  44. Glossina austeni tRNA tRNA-Val
  45. Glossina brevipalpis tRNA tRNA-Val
  46. Glossina fuscipes fuscipes tRNA
  47. Glossina fuscipes (Tsetse fly) tRNA-Val
  48. Glossina morsitans morsitans tRNA tRNA-Val
  49. Glossina pallidipes tRNA tRNA-Val
  50. Glossina palpalis gambiensis tRNA tRNA-Val
  51. Musca domestica (House fly) transfer RNA valine (anticodon UAC)
  52. Scaptodrosophila lebanonensis tRNA
  53. Stomoxys calcitrans (stable fly) transfer RNA valine (anticodon UAC)
Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Publications