v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila melanogaster (fruit fly) transfer RNA:Valine-TAC 1-1 (Dmel_CR32420, Dmel_CR32421) secondary structure diagram

Drosophila melanogaster (fruit fly) transfer RNA:Valine-TAC 1-1 (Dmel_CR32420, Dmel_CR32421) URS000043A2BD_7227

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGUUCCAUAGUGUAGCGGUUAUCACGUCUGCUUUACACGCAGAAGGUCUCCGGUUCGAUCCCGGAUGGAACCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 23 other species

  1. Drosophila ananassae tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  2. Drosophila busckii tRNA
  3. Drosophila erecta tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  4. Drosophila ficusphila tRNA
  5. Drosophila grimshawi tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  6. Drosophila guanche tRNA.Val
  7. Drosophila gunungcola tRNA-OTHER
  8. Drosophila mojavensis tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  9. Drosophila persimilis tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  10. Drosophila pseudoobscura pseudoobscura tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  11. Drosophila sechellia tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  12. Drosophila simulans tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  13. Drosophila virilis tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  14. Drosophila willistoni tRNA-Val (TAC) (tRNA-Val-TAC-1 1 to 4)
  15. Drosophila yakuba tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  16. Glossina austeni tRNA tRNA-Val
  17. Glossina brevipalpis tRNA tRNA-Val
  18. Glossina fuscipes fuscipes tRNA
  19. Glossina morsitans morsitans tRNA tRNA-Val
  20. Glossina pallidipes tRNA tRNA-Val
  21. Glossina palpalis gambiensis tRNA tRNA-Val
  22. Musca domestica tRNA MDOA013968
  23. Stomoxys calcitrans (Stable fly) tRNA-Val
 2D structure Publications