v26

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Glossina palpalis gambiensis (Tsetse fly) tRNA tRNA-Val secondary structure diagram

Glossina palpalis gambiensis (Tsetse fly) tRNA tRNA-Val URS000043A2BD_67801

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGUUCCAUAGUGUAGCGGUUAUCACGUCUGCUUUACACGCAGAAGGUCUCCGGUUCGAUCCCGGAUGGAACCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 45 other species

  1. Coremacera marginata (Sieve-winged Snailkiller) misc RNA ENSCNRG00005015312.1
  2. Drosophila albomicans (Fruit fly) transfer RNA valine (anticodon UAC)
  3. Drosophila ananassae tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  4. Drosophila arizonae (Fruit fly) tRNA-Val
  5. Drosophila biarmipes (Fruit fly) transfer RNA valine (anticodon UAC)
  6. Drosophila bipectinata (Fruit fly) tRNA-Val
  7. Drosophila busckii (Fruit fly) tRNA-Val
  8. Drosophila elegans (Fruit fly) tRNA-Val
  9. Drosophila erecta tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  10. Drosophila eugracilis (Fruit fly) tRNA-Val
  11. Drosophila ficusphila (Fruit fly) tRNA-Val
  12. Drosophila grimshawi tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  13. Drosophila guanche (Fruit fly) tRNA-Val
  14. Drosophila gunungcola (Fruit fly) transfer RNA valine (anticodon UAC)
  15. Drosophila hydei (Fruit fly) tRNA-Val
  16. Drosophila innubila (Fruit fly) tRNA-Val
  17. Drosophila kikkawai (Fruit fly) tRNA-Val
  18. Drosophila mauritiana (Fruit fly) tRNA-Val
  19. Drosophila melanogaster transfer RNA:Valine-TAC 1-1 (Dmel_CR32420, Dmel_CR32421)
  20. Drosophila miranda (Fruit fly) tRNA-Val
  21. Drosophila mojavensis tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  22. Drosophila navojoa (Fruit fly) tRNA-Val
  23. Drosophila obscura (Fruit fly) tRNA-Val
  24. Drosophila persimilis tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  25. Drosophila pseudoobscura (Fruit fly) tRNA-Val
  26. Drosophila pseudoobscura pseudoobscura tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  27. Drosophila rhopaloa (Fruit fly) tRNA-Val
  28. Drosophila santomea (Fruit fly) tRNA-Val
  29. Drosophila sechellia tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  30. Drosophila simulans tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  31. Drosophila subobscura (Fruit fly) tRNA-Val
  32. Drosophila subpulchrella (Fruit fly) tRNA-Val
  33. Drosophila suzukii (Fruit fly) tRNA-Val
  34. Drosophila takahashii (Fruit fly) tRNA-Val
  35. Drosophila teissieri (Fruit fly) tRNA-Val
  36. Drosophila virilis tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  37. Drosophila willistoni tRNA-Val (TAC) (tRNA-Val-TAC-1 1 to 4)
  38. Drosophila yakuba tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  39. Glossina austeni (Tsetse fly) tRNA tRNA-Val
  40. Glossina brevipalpis tRNA tRNA-Val
  41. Glossina fuscipes fuscipes tRNA
  42. Glossina morsitans morsitans tRNA tRNA-Val
  43. Glossina pallidipes tRNA tRNA-Val
  44. Musca domestica tRNA MDOA013968
  45. Scaptodrosophila lebanonensis tRNA
  46. Stomoxys calcitrans tRNA-Val
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...

 Publications