v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Musca domestica (House fly) tRNA MDOA013968 secondary structure diagram

Musca domestica (House fly) tRNA MDOA013968 URS000043A2BD_7370

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGUUCCAUAGUGUAGCGGUUAUCACGUCUGCUUUACACGCAGAAGGUCUCCGGUUCGAUCCCGGAUGGAACCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 23 other species

  1. Drosophila ananassae tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  2. Drosophila busckii tRNA
  3. Drosophila erecta tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  4. Drosophila ficusphila tRNA
  5. Drosophila grimshawi tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  6. Drosophila guanche tRNA.Val
  7. Drosophila gunungcola tRNA-OTHER
  8. Drosophila melanogaster transfer RNA:Valine-TAC 1-1 (Dmel_CR32420, Dmel_CR32421)
  9. Drosophila mojavensis tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  10. Drosophila persimilis tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  11. Drosophila pseudoobscura pseudoobscura tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  12. Drosophila sechellia tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  13. Drosophila simulans tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  14. Drosophila virilis tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  15. Drosophila willistoni tRNA-Val (TAC) (tRNA-Val-TAC-1 1 to 4)
  16. Drosophila yakuba tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  17. Glossina austeni tRNA tRNA-Val
  18. Glossina brevipalpis tRNA tRNA-Val
  19. Glossina fuscipes fuscipes tRNA
  20. Glossina morsitans morsitans tRNA tRNA-Val
  21. Glossina pallidipes tRNA tRNA-Val
  22. Glossina palpalis gambiensis tRNA tRNA-Val
  23. Stomoxys calcitrans (Stable fly) tRNA-Val
 2D structure Publications