Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan paniscus (pygmy chimpanzee) ppa-let-7a URS0000416056_9597

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGGUAGUAGGUUGUAUAGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 116 other species

  1. Acanthopleura granulata Agr-Let-7_5p (mature (guide))
  2. Alligator mississippiensis (American alligator) ami-let-7a-5p
  3. Anolis carolinensis (green anole) aca-let-7a-5p
  4. Ascaris suum (pig roundworm) asu-let-7-5p
  5. Ateles geoffroyi (black-handed spider monkey) microRNA let-7a-1
  6. Blattella germanica (German cockroach) Bge-Let-7_5p (mature (guide))
  7. Bos taurus (domestic cattle) bta-let-7a-5p
  8. Branchiostoma belcheri (Belcher's lancelet) bbe-let-7a-5p
  9. Branchiostoma floridae (Florida lancelet) bfl-let-7a-5p
  10. Branchiostoma lanceolatum (amphioxus) Bla-Let-7-P3_5p (mature (guide))
  11. Brugia malayi (agent of lymphatic filariasis) bma-let-7
  12. Caenorhabditis brenneri cbn-let-7
  13. Caenorhabditis briggsae cbr-let-7
  14. Caenorhabditis elegans cel-let-7-5p
  15. Caenorhabditis remanei crm-let-7
  16. Callithrix jacchus (white-tufted-ear marmoset) cja-let-7a
  17. Callorhinchus milii Cmi-Let-7-P2b4_5p (mature (guide))
  18. Canis lupus familiaris cfa-let-7a
  19. Capra hircus chi-let-7a-5p
  20. Cavia porcellus (domestic guinea pig) cpo-let-7a-5p
  21. Centruroides sculpturatus Csc-Let-7-P18b_5p (mature (guide))
  22. Cervus elaphus (red deer) cel-let-7a
  23. Chiloscyllium plagiosum microRNA cpl-let-7e
  24. Chrysemys picta bellii (western painted turtle) Cpi-Let-7-P2b4_5p (mature (guide))
  25. Chrysemys picta cpi-let-7a-5p
  26. Columba livia cli-let-7a-5p
  27. Cricetulus griseus cgr-let-7a
  28. Cyprinus carpio (common carp) ccr-let-7a
  29. Danio rerio dre-let-7a
  30. Dasypus novemcinctus (nine-banded armadillo) dno-let-7a-5p
  31. Daubentonia madagascariensis (aye-aye) dma-let-7a
  32. Echinops telfairi (small Madagascar hedgehog) Ete-Let-7-P2a1_5p (mature (guide))
  33. Epimenia babai Eba-Let-7_5p (mature (guide))
  34. Eptatretus burgeri Ebu-Let-7-P2o6_5p (mature (guide))
  35. Equus caballus eca-let-7a
  36. Euprymna scolopes Esc-Let-7_5p (mature (guide))
  37. Gadus morhua (Atlantic cod) gmo-let-7a-5p
  38. Gallus gallus gga-let-7j-5p
  39. Gekko japonicus Gja-Let-7-P2b4_5p (mature (guide))
  40. Gorilla gorilla microRNA let-7a-1
  41. Haliotis rufescens (red abalone) Hru-Let-7_5p (mature (guide))
  42. Haplochromis burtoni abu-let-7a
  43. Heligmosomoides polygyrus hpo-let-7-5p
  44. Homo sapiens (human) hsa-let-7a-5p
  45. Ictalurus punctatus ipu-let-7a
  46. Ixodes ricinus iri-let-7-5p
  47. Ixodes scapularis (black-legged tick) Isc-Let-7_5p (mature (guide))
  48. Laevipilina hyalina Lhy-Let-7_5p (mature (guide))
  49. Lagothrix lagotricha microRNA let-7a-1
  50. Latimeria chalumnae Lch-Let-7-P2b4_5p (mature (guide))
  51. Lemur catta (Ring-tailed lemur) microRNA let-7a-1
  52. Lepisosteus oculatus Loc-Let-7-P2b4_5p (mature (guide))
  53. Limulus polyphemus Lpo-Let-7-P17_5p (mature (guide))
  54. Lineus longissimus Llo-Let-7_5p (mature (guide))
  55. Lingula anatina Lan-Let-7_5p (mature (guide))
  56. Lottia gigantea (owl limpet) lgi-let-7
  57. Loxodonta africana (African savanna elephant) Laf-Let-7-P2a1_5p (mature (guide))
  58. Macaca mulatta mml-let-7a-5p
  59. Macaca nemestrina microRNA let-7a-1
  60. Magallana gigas (Pacific oyster) Mgi-Let-7_5p (mature (guide))
  61. Maylandia zebra (zebra mbuna) mze-let-7a
  62. Microcaecilia unicolor Mun-Let-7-P2b4_5p (mature (guide))
  63. Microcebus murinus mmr-let-7a
  64. Monodelphis domestica (gray short-tailed opossum) mdo-let-7a-5p
  65. Monopterus albus (swamp eel) Mal-Let-7-P2b4b_5p (mature (guide))
  66. Mopalia muscosa Mom-Let-7_5p (mature (guide))
  67. Mus musculus (house mouse) mmu-let-7a-5p
  68. Nautilus pompilius Npo-Let-7_5p (mature (guide))
  69. Neolamprologus brichardi (lyretail cichlid) nbr-let-7a
  70. Nomascus leucogenys (northern white-cheeked gibbon) nle-let-7a
  71. Notamacropus eugenii (tammar wallaby) Neu-Let-7-P1d_5p (mature (guide))
  72. Octopus bimaculoides Obi-Let-7_5p (mature (guide))
  73. Octopus vulgaris (common octopus) Ovu-Let-7_5p (mature (guide))
  74. Ophiophagus hannah (king cobra) oha-let-7a-5p
  75. Oreochromis niloticus (Nile tilapia) oni-let-7a
  76. Ornithorhynchus anatinus Oan-Let-7-P2b4_5p (mature (guide))
  77. Oryctolagus cuniculus (rabbit) ocu-let-7a-5p
  78. Oryzias latipes (Japanese medaka) ola-let-7a
  79. Otolemur garnettii oga-let-7a
  80. Ovis aries (sheep) oar-let-7a
  81. Owenia fusiformis Ofu-Let-7_5p (mature (guide))
  82. Pan troglodytes ptr-let-7a
  83. Papio hamadryas (hamadryas baboon) pha-let-7a
  84. Parasteatoda tepidariorum (common house spider) pte-let-7-5p
  85. Penaeus japonicus miR-let7
  86. Petromyzon marinus (sea lamprey) pma-let-7a
  87. Pictodentalium vernedei Pve-Let-7_5p (mature (guide))
  88. Pongo abelii (Sumatran orangutan) Pab-Let-7-P2a1_5p (mature (guide))
  89. Pongo pygmaeus ppy-let-7a
  90. Priapulus caudatus Pca-Let-7_5p (mature (guide))
  91. Pristionchus pacificus ppc-let-7
  92. Pteropus alecto pal-let-7a-5p
  93. Ptychodera flava Pfl-Let-7_5p (mature (guide))
  94. Pundamilia nyererei pny-let-7a
  95. Python bivittatus (Burmese python) pbv-let-7a-5p
  96. Rattus norvegicus rno-let-7a-5p
  97. synthetic construct RNA (5'-R(P*UP*GP*AP*GP*GP*UP*AP*GP*UP*AP*GP*GP*UP*UP*GP*UP*AP*UP*AP*GP*UP*U)-3'... from None (PDB 4KRF, chain R)
  98. Ruditapes philippinarum (Manila clam) Rph-Let-7_5p (mature (guide))
  99. Saccoglossus kowalevskii sko-let-7
  100. Saguinus labiatus microRNA let-7a-1
  101. Saimiri boliviensis boliviensis sbo-let-7a
  102. Salmo salar (Atlantic salmon) ssa-let-7a-5p
  103. Sarcophilus harrisii (Tasmanian devil) Sha-Let-7-P2a1_5p (mature (guide))
  104. Scyliorhinus torazame Sto-Let-7-P2b3_5p (mature (guide))
  105. Sipunculus nudus (marine worm) Snu-Let-7_5p (mature (guide))
  106. Sphenodon punctatus (tuatara) Spt-Let-7-P2b4_5p (mature (guide))
  107. Sus scrofa ssc-let-7a
  108. Taeniopygia guttata tgu-let-7a-5p
  109. Takifugu rubripes fru-let-7a
  110. Tetraodon nigroviridis (spotted green pufferfish) tni-let-7a
  111. Tor tambroides let-7a
  112. Tursiops truncatus let-7a
  113. Wirenia argentea War-Let-7_5p (mature (guide))
  114. Xenopus laevis xla-let-7a-5p
  115. Xenopus tropicalis xtr-let-7a
  116. Xenoturbella bocki Xbo-Let-7_5p (mature (guide))
Relationships New

Molecular Relationships

Publications