v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ovis aries (sheep) oar-let-7a URS0000416056_9940

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

oar-let-7a: Oar-let-7a is a highly expressed miRNA in sheep milk extracellular vesicles (EVs) and is a member of the let-7 family of miRNAs [PMC3804049]. It is the second most abundantly expressed miRNA in the dataset, with an expression level nearly six-fold lower than the most highly expressed miRNA [PMC3804049]. Sheep milk EVs also contain other let-7 family miRNAs, including oar-let-7c, oar-let-7i, and oar-let-7g [PMC7070426]. Oar-miR-148a, oar-miR-21, and oar-miR125b are highly expressed in ovine ovarian follicles along with oar-let-7a [PMC4287553]. Oar-miR148a, oar-miR21, and two instances of oarlet7b are among the top five differentially expressed miRNAs in sheep ovaries and have also been found to be highly expressed in ovaries of other animal species [PMC7971002]. The EDEM1 gene regulates multiple let7 family members including oarlet 7a [PMC9656243]. Ovarian expression of oarmir 148a has been found to be crucial for reproduction in sheep during different reproductive stages [PMC7992348]. Oarmir 148a is also highly expressed during all reproductive stages along with other members of the let 7 family including two instances of let 7b and let 7c[PMC7992348][PMC7070426][PMC9656243][ PMC4287553][ PMC7971002]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGAGGUAGUAGGUUGUAUAGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 101 other species

  1. Alligator mississippiensis ami-let-7a-5p
  2. Anolis carolinensis (green anole) aca-let-7a-5p
  3. Ascaris suum (pig roundworm) asu-let-7-5p
  4. Ateles geoffroyi (black-handed spider monkey) microRNA let-7a-1
  5. Blattella germanica Bge-Let-7_5p (mature (guide))
  6. Bos taurus (cattle) bta-let-7a-5p
  7. Branchiostoma belcheri bbe-let-7a-5p
  8. Branchiostoma floridae (Florida lancelet) bfl-let-7a-5p
  9. Branchiostoma lanceolatum (amphioxus) Bla-Let-7-P3_5p (mature (guide))
  10. Brugia malayi (agent of lymphatic filariasis) bma-let-7
  11. Caenorhabditis brenneri cbn-let-7
  12. Caenorhabditis briggsae cbr-let-7
  13. Caenorhabditis elegans cel-let-7-5p
  14. Caenorhabditis remanei crm-let-7
  15. Callithrix jacchus (white-tufted-ear marmoset) cja-let-7a
  16. Callorhinchus milii (elephant shark) Cmi-Let-7-P2b4_5p (mature (guide))
  17. Canis lupus familiaris (dog) cfa-let-7a
  18. Capra hircus chi-let-7a-5p
  19. Cavia porcellus (domestic guinea pig) cpo-let-7a-5p
  20. Centruroides sculpturatus Csc-Let-7-P18b_5p (mature (guide))
  21. Cervus elaphus (red deer) cel-let-7a
  22. Chiloscyllium plagiosum microRNA cpl-let-7e
  23. Chrysemys picta bellii (western painted turtle) Cpi-Let-7-P2b4_5p (mature (guide))
  24. Chrysemys picta cpi-let-7a-5p
  25. Columba livia cli-let-7a-5p
  26. Crassostrea gigas Cgi-Let-7_5p (mature (guide))
  27. Cricetulus griseus (Chinese hamster) cgr-let-7a
  28. Cyprinus carpio (common carp) ccr-let-7a
  29. Danio rerio dre-let-7a
  30. Dasypus novemcinctus dno-let-7a-5p
  31. Daubentonia madagascariensis (aye-aye) dma-let-7a
  32. Echinops telfairi Ete-Let-7-P2a1_5p (mature (guide))
  33. Eptatretus burgeri Ebu-Let-7-P2o6_5p (mature (guide))
  34. Equus caballus (horse) eca-let-7a
  35. Euprymna scolopes Esc-Let-7_5p (mature (guide))
  36. Gadus morhua gmo-let-7a-5p
  37. Gallus gallus gga-let-7j-5p
  38. Gekko japonicus Gja-Let-7-P2b4_5p (mature (guide))
  39. Gorilla gorilla (western gorilla) microRNA let-7a-1
  40. Haplochromis burtoni abu-let-7a
  41. Heligmosomoides polygyrus hpo-let-7-5p
  42. Homo sapiens (human) hsa-let-7a-5p
  43. Ictalurus punctatus ipu-let-7a
  44. Ixodes ricinus (castor bean tick) iri-let-7-5p
  45. Ixodes scapularis (black-legged tick) Isc-Let-7_5p (mature (guide))
  46. Lagothrix lagotricha (brown woolly monkey) microRNA let-7a-1
  47. Latimeria chalumnae (coelacanth) Lch-Let-7-P2b4_5p (mature (guide))
  48. Lemur catta microRNA let-7a-1
  49. Lepisosteus oculatus Loc-Let-7-P2b4_5p (mature (guide))
  50. Limulus polyphemus (Atlantic horseshoe crab) Lpo-Let-7-P17_5p (mature (guide))
  51. Lingula anatina Lan-Let-7_5p (mature (guide))
  52. Lottia gigantea (owl limpet) lgi-let-7
  53. Macaca mulatta (Rhesus monkey) mml-let-7a-5p
  54. Macaca nemestrina microRNA let-7a-1
  55. Maylandia zebra mze-let-7a
  56. Microcaecilia unicolor Mun-Let-7-P2b4_5p (mature (guide))
  57. Microcebus murinus (gray mouse lemur) mmr-let-7a
  58. Monodelphis domestica mdo-let-7a-5p
  59. Monopterus albus Mal-Let-7-P2b4b_5p (mature (guide))
  60. Mus musculus mmu-let-7a-5p
  61. Nautilus pompilius Npo-Let-7_5p (mature (guide))
  62. Neolamprologus brichardi (lyretail cichlid) nbr-let-7a
  63. Nomascus leucogenys (northern white-cheeked gibbon) nle-let-7a
  64. Octopus bimaculoides Obi-Let-7_5p (mature (guide))
  65. Octopus vulgaris Ovu-Let-7_5p (mature (guide))
  66. Ophiophagus hannah oha-let-7a
  67. Oreochromis niloticus (Nile tilapia) oni-let-7a
  68. Ornithorhynchus anatinus (platypus) Oan-Let-7-P2b4_5p (mature (guide))
  69. Oryctolagus cuniculus ocu-let-7a-5p
  70. Oryzias latipes ola-let-7a
  71. Otolemur garnettii oga-let-7a
  72. Pan paniscus ppa-let-7a
  73. Pan troglodytes ptr-let-7a
  74. Papio hamadryas pha-let-7a
  75. Parasteatoda tepidariorum pte-let-7-5p
  76. Penaeus japonicus miR-let7
  77. Petromyzon marinus (sea lamprey) pma-let-7a
  78. Pongo pygmaeus (Bornean orangutan) ppy-let-7a
  79. Pristionchus pacificus ppc-let-7
  80. Pteropus alecto pal-let-7a-5p
  81. Ptychodera flava Pfl-Let-7_5p (mature (guide))
  82. Pundamilia nyererei pny-let-7a
  83. Python bivittatus (Burmese python) pbv-let-7a-5p
  84. Rattus norvegicus (Norway rat) rno-let-7a-5p
  85. synthetic construct RNA (5'-R(P*UP*GP*AP*GP*GP*UP*AP*GP*UP*AP*GP*GP*UP*UP*GP*UP*AP*UP*AP*GP*UP*U)-3'... from None (PDB 4KRF, chain R)
  86. Saccoglossus kowalevskii sko-let-7
  87. Saguinus labiatus microRNA let-7a-1
  88. Saimiri boliviensis boliviensis sbo-let-7a
  89. Salmo salar (Atlantic salmon) ssa-let-7a-5p
  90. Sarcophilus harrisii Sha-Let-7-P2a1_5p (mature (guide))
  91. Scyliorhinus torazame Sto-Let-7-P2b3_5p (mature (guide))
  92. Sphenodon punctatus (tuatara) Spt-Let-7-P2b4_5p (mature (guide))
  93. Sus scrofa ssc-let-7a
  94. Taeniopygia guttata (zebra finch) tgu-let-7a-5p
  95. Takifugu rubripes fru-let-7a
  96. Tetraodon nigroviridis (spotted green pufferfish) tni-let-7a
  97. Tor tambroides (Thai mahseer) let-7a
  98. Tursiops truncatus (common bottlenose dolphin) let-7a
  99. Xenopus laevis (African clawed frog) xla-let-7a-5p
  100. Xenopus tropicalis (tropical clawed frog) xtr-let-7a
  101. Xenoturbella bocki Xbo-Let-7_5p (mature (guide))
 Publications