Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-30d URS00004150D5_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-30d: Ssc-mir-30d is a type of microRNA that is expressed at higher levels during the prenatal stage compared to the neonatal stage, and its expression pattern during muscle development reflects its relationship with myogenesis [PMC4423774]. It is one of the nine differentially expressed miRNAs that were validated through RT-qPCR [PMC4423774]. Ssc-mir-30d is one of the most abundant miRNAs at E90, along with ssc-miR-206 and ssc-miR-1 [PMC4423774]. It is also among the most abundant miRNAs in different samples, such as in LPS-treated and control groups [PMC7903524]. Ssc-mir-30d has been found to be up-regulated during YN144 infection and down-regulated during YN15 infection [PMC7820490]. It has been shown to regulate pathogenicity-related signaling pathways, including NF-κB and JAK-STAT pathways [PMC7820490]. In SLN, ssc-mir-30d was down-regulated at 7 dpi, coinciding with the detection of cytokines and immune mediators, as well as leucopenia and hemorrhages in infected animals [PMC5646143]. A SNP located in the precursor 3' stem of ssc-mir-30d has been associated with arachidic acid content [PMC8097994]. Ssc-mir-30d is expressed abundantly in skeletal muscles but is not classified as a myomiR [PMC3528764].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUAAACAUCCCCGACUGGAAGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 43 other species

  1. Alligator mississippiensis ami-miR-30d-5p
  2. Anolis carolinensis (green anole) Aca-Mir-30-P1a_5p (mature (guide))
  3. Bos taurus (cattle) bta-miR-30d
  4. Callithrix jacchus (white-tufted-ear marmoset) Callithrix_jacchus piRNA piR-cja-1114887
  5. Callorhinchus milii (elephant shark) Cmi-Mir-30-P1a_5p (mature (guide))
  6. Canis lupus familiaris (dog) cfa-miR-30d
  7. Cavia porcellus (domestic guinea pig) cpo-miR-30d-5p
  8. Cervus elaphus (red deer) cel-miR-30d
  9. Chrysemys picta bellii (western painted turtle) Cpi-Mir-30-P1a_5p (mature (guide))
  10. Columba livia cli-miR-30d-5p
  11. Danio rerio Dre-Mir-30-P1a_5p (mature (guide))
  12. Dasypus novemcinctus dno-miR-30d-5p
  13. Drosophila erecta Drosophila_erecta piRNA piR-der-861394
  14. Drosophila melanogaster Drosophila_melanogaster piRNA piR-dme-21349617
  15. Echinops telfairi Ete-Mir-30-P1a_5p (mature (guide))
  16. Gadus morhua gmo-miR-30a-5p
  17. Gallus gallus Gga-Mir-30-P1a_5p (mature (guide))
  18. Gekko japonicus Gja-Mir-30-P1a_5p (mature (guide))
  19. Homo sapiens (human) Hsa-Mir-30-P1a_5p (mature (guide))
  20. Latimeria chalumnae (coelacanth) Lch-Mir-30-P1a_5p (mature (guide))
  21. Lepisosteus oculatus Loc-Mir-30-P1a_5p (mature (guide))
  22. Macaca mulatta (Rhesus monkey) Mml-Mir-30-P1a_5p (mature (guide))
  23. Microcaecilia unicolor Mun-Mir-30-P1a_5p (mature (guide))
  24. Monodelphis domestica Mdo-Mir-30-P1a_5p (mature (guide))
  25. Monopterus albus Mal-Mir-30-P1a_5p (mature (guide))
  26. Mus musculus Mmu-Mir-30-P1a_5p (mature (guide))
  27. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-30d
  28. Ophiophagus hannah oha-miR-30d-5p
  29. Ornithorhynchus anatinus (platypus) Oan-Mir-30-P1a_5p (mature (guide))
  30. Oryctolagus cuniculus ocu-miR-30d-5p
  31. Otolemur garnettii oga-miR-30d
  32. Papio hamadryas pha-miR-30d
  33. Pteropus alecto pal-miR-30d-5p
  34. Python bivittatus (Burmese python) pbv-miR-30d-5p
  35. Rattus norvegicus (Norway rat) Rno-Mir-30-P1a_5p (mature (guide))
  36. Salmo salar (Atlantic salmon) ssa-miR-30b-5p
  37. Sarcophilus harrisii Sha-Mir-30-P1a_5p (mature (guide))
  38. Scyliorhinus torazame Sto-Mir-30-P1a_5p (mature (guide))
  39. Sphenodon punctatus (tuatara) Spt-Mir-30-P1a_5p (mature (guide))
  40. Taeniopygia guttata (zebra finch) tgu-miR-30d-5p
  41. Tetraodon nigroviridis (spotted green pufferfish) Tni-Mir-30-P1a_5p (mature (guide))
  42. Xenopus laevis (African clawed frog) xla-miR-30d-5p
  43. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-30-P1a_5p (mature (guide))
Publications