Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) Dre-Mir-30-P1a_5p (mature (guide)) URS00004150D5_7955

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUAAACAUCCCCGACUGGAAGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 43 other species

  1. Alligator mississippiensis ami-miR-30d-5p
  2. Anolis carolinensis (green anole) Aca-Mir-30-P1a_5p (mature (guide))
  3. Bos taurus (cattle) bta-miR-30d
  4. Callithrix jacchus (white-tufted-ear marmoset) Callithrix_jacchus piRNA piR-cja-1114887
  5. Callorhinchus milii (elephant shark) Cmi-Mir-30-P1a_5p (mature (guide))
  6. Canis lupus familiaris (dog) cfa-miR-30d
  7. Cavia porcellus (domestic guinea pig) cpo-miR-30d-5p
  8. Cervus elaphus (red deer) cel-miR-30d
  9. Chrysemys picta bellii (western painted turtle) Cpi-Mir-30-P1a_5p (mature (guide))
  10. Columba livia cli-miR-30d-5p
  11. Dasypus novemcinctus dno-miR-30d-5p
  12. Drosophila erecta Drosophila_erecta piRNA piR-der-861394
  13. Drosophila melanogaster Drosophila_melanogaster piRNA piR-dme-21349617
  14. Echinops telfairi Ete-Mir-30-P1a_5p (mature (guide))
  15. Gadus morhua gmo-miR-30a-5p
  16. Gallus gallus Gga-Mir-30-P1a_5p (mature (guide))
  17. Gekko japonicus Gja-Mir-30-P1a_5p (mature (guide))
  18. Homo sapiens (human) Hsa-Mir-30-P1a_5p (mature (guide))
  19. Latimeria chalumnae (coelacanth) Lch-Mir-30-P1a_5p (mature (guide))
  20. Lepisosteus oculatus Loc-Mir-30-P1a_5p (mature (guide))
  21. Macaca mulatta (Rhesus monkey) Mml-Mir-30-P1a_5p (mature (guide))
  22. Microcaecilia unicolor Mun-Mir-30-P1a_5p (mature (guide))
  23. Monodelphis domestica Mdo-Mir-30-P1a_5p (mature (guide))
  24. Monopterus albus Mal-Mir-30-P1a_5p (mature (guide))
  25. Mus musculus Mmu-Mir-30-P1a_5p (mature (guide))
  26. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-30d
  27. Ophiophagus hannah oha-miR-30d-5p
  28. Ornithorhynchus anatinus (platypus) Oan-Mir-30-P1a_5p (mature (guide))
  29. Oryctolagus cuniculus ocu-miR-30d-5p
  30. Otolemur garnettii oga-miR-30d
  31. Papio hamadryas pha-miR-30d
  32. Pteropus alecto pal-miR-30d-5p
  33. Python bivittatus (Burmese python) pbv-miR-30d-5p
  34. Rattus norvegicus (Norway rat) Rno-Mir-30-P1a_5p (mature (guide))
  35. Salmo salar (Atlantic salmon) ssa-miR-30b-5p
  36. Sarcophilus harrisii Sha-Mir-30-P1a_5p (mature (guide))
  37. Scyliorhinus torazame Sto-Mir-30-P1a_5p (mature (guide))
  38. Sphenodon punctatus (tuatara) Spt-Mir-30-P1a_5p (mature (guide))
  39. Sus scrofa ssc-miR-30d
  40. Taeniopygia guttata (zebra finch) tgu-miR-30d-5p
  41. Tetraodon nigroviridis (spotted green pufferfish) Tni-Mir-30-P1a_5p (mature (guide))
  42. Xenopus laevis (African clawed frog) xla-miR-30d-5p
  43. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-30-P1a_5p (mature (guide))