Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-181a-5p URS00003DA300_9606

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Homo sapiens. Annotated by 10 databases (TarBase, IntAct, GeneCards, miRBase, PSICQUIC, ENA, MalaCards, RefSeq, MirGeneDB, LncBase). Described in 115 papers. Homo sapiens (human) hsa-miR-181a-5p sequence is a product of MIR181A2, miR-181a, MIR181A1, hsa-miR-181a, hsa-miR-181a-5p, miR-181a-5p, miR-181 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 1-Cys, 12CC4, 14-3-3GAMMA, 14-3-3γ, 15E1.2, 16.3A5, 182-FIP, 1A6/DRIM, 2'-PDE, 2310047H23Rik.

Interactions 26

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-181a-5p interacts with:

Interaction id Participant Synonyms
EBI-25297780 intact:EBI-25297770 EBI-25297770 ENST00000228872 mrna_cdkn1b
EBI-25297787 intact:EBI-25297842 EBI-25297842 ENST00000322886 mrna_e2f7
URS00003DA300_9606-13 O00571 O00571
URS00003DA300_9606-0 O00571 O00571
URS00003DA300_9606-1 O95831 O95831
URS00003DA300_9606-14 O95831 O95831
URS00003DA300_9606-2 P00797 P00797
URS00003DA300_9606-15 P00797 P00797
URS00003DA300_9606-3 P01375 P01375
URS00003DA300_9606-4 P06401 P06401
URS00003DA300_9606-16 P06401 P06401
URS00003DA300_9606-17 P10145 P10145
URS00003DA300_9606-5 P10145 P10145
URS00003DA300_9606-6 P14867 P14867
URS00003DA300_9606-18 P14867 P14867
URS00003DA300_9606-19 P35625 P35625
URS00003DA300_9606-7 P35625 P35625
URS00003DA300_9606-20 P42262 P42262
URS00003DA300_9606-8 P42262 P42262
URS00003DA300_9606-9 Q8WXG6 Q8WXG6
URS00003DA300_9606-21 Q8WXG6 Q8WXG6
URS00003DA300_9606-22 Q92831 Q92831
URS00003DA300_9606-10 Q92831 Q92831
URS00003DA300_9606-11 Q9Y6W6 Q9Y6W6
URS00003DA300_9606-12 Q9Y6W6 Q9Y6W6
URS00003DA300_9606-23 Q9Y6W6 Q9Y6W6

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AACAUUCAACGCUGUCGGUGAGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 109 other species

    1. Alligator mississippiensis ami-miR-181a-5p
    2. Anolis carolinensis aca-miR-181a
    3. Bos taurus (cattle) Bta-Mir-181-P1b_5p (mature (guide))
    4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-181a
    5. Callorhinchus milii (elephant shark) eshark_mir-181_4
    6. Canis lupus familiaris (dog) Cfa-Mir-181-P1b_5p (mature (guide))
    7. Capra hircus miR-181a
    8. Cavia porcellus Cpo-Mir-181-P1b_5p (mature (guide))
    9. Cervus elaphus (red deer) cel-miR-181a
    10. Chrysemys picta bellii Cpi-Mir-181-P1b_5p (mature (guide))
    11. Chrysemys picta cpi-miR-181a-5p
    12. Columba livia Cli-Mir-181-P1b_5p (mature (guide))
    13. Cricetulus griseus (Chinese hamster) cgr-miR-181a-5p
    14. Danio rerio dre-miR-181a-5p
    15. Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-181-P1b_5p (mature (guide))
    16. Daubentonia madagascariensis dma-miR-181a
    17. Echinops telfairi Ete-Mir-181-P1b_5p (mature (guide))
    18. Equus caballus eca-miR-181a
    19. Gadus morhua (Atlantic cod) gmo-miR-181a-5p
    20. Gallus gallus (chicken) gga-miR-181a-5p
    21. Gorilla gorilla (western gorilla) ggo-miR-181a-5p
    22. Lagothrix lagotricha (brown woolly monkey) lla-miR-181a-5p
    23. Macaca mulatta mml-miR-181a-5p
    24. Macaca nemestrina mne-miR-181a-5p
    25. Monodelphis domestica (gray short-tailed opossum) mdo-miR-181a-5p
    26. Mus musculus mmu-miR-181a-5p
    27. Nomascus leucogenys nle-miR-181a
    28. Ornithorhynchus anatinus oan-miR-181a-5p
    29. Oryctolagus cuniculus Ocu-Mir-181-P1b_5p (mature (guide))
    30. Otolemur garnettii oga-miR-181a
    31. Ovis aries (sheep) oar-miR-181a
    32. Pan paniscus ppa-miR-181a-5p
    33. Pan troglodytes (chimpanzee) ptr-miR-181a-5p
    34. Papio hamadryas pha-miR-181a
    35. Petromyzon marinus (sea lamprey) pma-miR-181a-5p
    36. Pongo pygmaeus ppy-miR-181a-5p
    37. Rattus norvegicus rno-miR-181a-5p
    38. Saguinus labiatus sla-miR-181a
    39. Salmo salar ssa-miR-181a-5p
    40. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-181-P1b_5p (mature (guide))
    41. Scyliorhinus torazame (cloudy catshark) Sto-Mir-181-P1b_5p (mature (guide))
    42. Taeniopygia guttata (zebra finch) tgu-miR-181a-5p
    43. Takifugu rubripes fru-miR-181a-5p
    44. Tetraodon nigroviridis tni-miR-181a-5p
    45. Tor tambroides miR-181a-5p
    46. Tupaia chinensis (Chinese tree shrew) tch-miR-181a-5p
    47. Xenopus tropicalis xtr-miR-181a-5p