Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Gorilla gorilla gorilla ggo-miR-181a-5p (MIR181A-2) secondary structure diagram

Gorilla gorilla gorilla ggo-miR-181a-5p (MIR181A-2) URS00003DA300_9595

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AACAUUCAACGCUGUCGGUGAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 60 other species

  1. Alligator mississippiensis (American alligator) ami-miR-181a-5p
  2. Anolis carolinensis aca-miR-181a
  3. Bos taurus (domestic cattle) Bta-Mir-181-P1b_5p (mature (guide))
  4. Callithrix jacchus cja-miR-181a
  5. Callorhinchus milii Cmi-Mir-181-P1c_5p (mature (guide))
  6. Canis lupus familiaris (dog) Cfa-Mir-181-P1b_5p (mature (guide))
  7. Capra hircus (goat) miR-181a
  8. Cavia porcellus Cpo-Mir-181-P1b_5p (mature (guide))
  9. Cervus elaphus cel-miR-181a
  10. Chrysemys picta bellii (western painted turtle) Cpi-Mir-181-P1b_5p (mature (guide))
  11. Chrysemys picta cpi-miR-181a-5p
  12. Columba livia Cli-Mir-181-P1b_5p (mature (guide))
  13. Cricetulus griseus (Chinese hamster) cgr-miR-181a-5p
  14. Danio rerio (zebrafish) dre-miR-181a-5p
  15. Dasypus novemcinctus Dno-Mir-181-P1b_5p (mature (guide))
  16. Daubentonia madagascariensis (aye-aye) dma-miR-181a
  17. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-181-P1b_5p (mature (guide))
  18. Eptatretus burgeri Ebu-Mir-181-P1f_5p (mature (guide))
  19. Equus caballus eca-miR-181a
  20. Gadus morhua gmo-miR-181a-5p
  21. Gallus gallus (chicken) gga-miR-181a-5p
  22. Gekko japonicus Gja-Mir-181-P1b_5p (mature (guide))
  23. Gorilla gorilla ggo-miR-181a-5p
  24. Homo sapiens hsa-miR-181a-5p
  25. Lagothrix lagotricha (brown woolly monkey) lla-miR-181a-5p
  26. Latimeria chalumnae (coelacanth) Lch-Mir-181-P1b_5p (mature (guide))
  27. Lepisosteus oculatus (spotted gar) Loc-Mir-181-P1b_5p (mature (guide))
  28. Loxodonta africana (African savanna elephant) Laf-Mir-181-P1b_5p (mature (guide))
  29. Macaca mulatta (Rhesus monkey) mml-miR-181a-5p
  30. Macaca nemestrina mne-miR-181a-5p
  31. Microcaecilia unicolor Mun-Mir-181-P1b_5p (mature (guide))
  32. Microcebus murinus (gray mouse lemur) Mmr-Mir-181-P1b_5p (mature (guide))
  33. Monodelphis domestica (gray short-tailed opossum) mdo-miR-181a-5p
  34. Mus musculus mmu-miR-181a-5p
  35. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-181a
  36. Notamacropus eugenii (tammar wallaby) Neu-Mir-181-P1b_5p (mature (guide))
  37. Ornithorhynchus anatinus oan-miR-181a-5p
  38. Oryctolagus cuniculus Ocu-Mir-181-P1b_5p (mature (guide))
  39. Otolemur garnettii (small-eared galago) oga-miR-181a
  40. Ovis aries (sheep) oar-miR-181a
  41. Pan paniscus ppa-miR-181a-5p
  42. Pan troglodytes (chimpanzee) ptr-miR-181a-5p
  43. Papio hamadryas (hamadryas baboon) pha-miR-181a
  44. Petromyzon marinus pma-miR-181a-5p
  45. Pongo abelii (Sumatran orangutan) Pab-Mir-181-P1b_5p (mature (guide))
  46. Pongo pygmaeus (Bornean orangutan) ppy-miR-181a-5p
  47. Python bivittatus (Burmese python) Pbv-Mir-181-P1c_5p (mature (guide))
  48. Rattus norvegicus rno-miR-181a-5p
  49. Saguinus labiatus (red-chested mustached tamarin) sla-miR-181a
  50. Salmo salar (Atlantic salmon) ssa-miR-181a-5p
  51. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-181-P1b_5p (mature (guide))
  52. Scyliorhinus torazame (cloudy catshark) Sto-Mir-181-P1b_5p (mature (guide))
  53. Sphenodon punctatus Spt-Mir-181-P1b_5p (mature (guide))
  54. Taeniopygia guttata (zebra finch) tgu-miR-181a-5p
  55. Takifugu rubripes (torafugu) fru-miR-181a-5p
  56. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-181a-5p
  57. Tor tambroides (Thai mahseer) miR-181a-5p
  58. Tupaia chinensis tch-miR-181a-5p
  59. Xenopus laevis (African clawed frog) Xla-Mir-181-P1a3_5p* (star (passenger))
  60. Xenopus tropicalis (tropical clawed frog) xtr-miR-181a-5p
Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Publications