Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ornithorhynchus anatinus (platypus) oan-miR-181a-5p URS00003DA300_9258

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AACAUUCAACGCUGUCGGUGAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 55 other species

  1. Alligator mississippiensis ami-miR-181a-5p
  2. Anolis carolinensis aca-miR-181a
  3. Bos taurus Bta-Mir-181-P1b_5p (mature (guide))
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-181a
  5. Callorhinchus milii (elephant shark) Cmi-Mir-181-P1c_5p (mature (guide))
  6. Canis lupus familiaris Cfa-Mir-181-P1b_5p (mature (guide))
  7. Capra hircus miR-181a
  8. Cavia porcellus (domestic guinea pig) Cpo-Mir-181-P1b_5p (mature (guide))
  9. Cervus elaphus (red deer) cel-miR-181a
  10. Chrysemys picta bellii Cpi-Mir-181-P1b_5p (mature (guide))
  11. Chrysemys picta (Painted turtle) cpi-miR-181a-5p
  12. Columba livia Cli-Mir-181-P1b_5p (mature (guide))
  13. Cricetulus griseus (Chinese hamster) cgr-miR-181a-5p
  14. Danio rerio (zebrafish) dre-miR-181a-5p
  15. Dasypus novemcinctus Dno-Mir-181-P1b_5p (mature (guide))
  16. Daubentonia madagascariensis dma-miR-181a
  17. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-181-P1b_5p (mature (guide))
  18. Eptatretus burgeri (inshore hagfish) Ebu-Mir-181-P1f_5p (mature (guide))
  19. Equus caballus (horse) eca-miR-181a
  20. Gadus morhua (Atlantic cod) gmo-miR-181a-5p
  21. Gallus gallus gga-miR-181a-5p
  22. Gekko japonicus Gja-Mir-181-P1b_5p (mature (guide))
  23. Gorilla gorilla gorilla ggo-miR-181a-5p (MIR181A-2)
  24. Gorilla gorilla (western gorilla) ggo-miR-181a-5p
  25. Homo sapiens hsa-miR-181a-5p
  26. Lagothrix lagotricha lla-miR-181a-5p
  27. Latimeria chalumnae (coelacanth) Lch-Mir-181-P1b_5p (mature (guide))
  28. Lepisosteus oculatus Loc-Mir-181-P1b_5p (mature (guide))
  29. Macaca mulatta mml-miR-181a-5p
  30. Macaca nemestrina mne-miR-181a-5p
  31. Microcaecilia unicolor Mun-Mir-181-P1b_5p (mature (guide))
  32. Monodelphis domestica mdo-miR-181a-5p
  33. Mus musculus mmu-miR-181a-5p
  34. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-181a
  35. Oryctolagus cuniculus (rabbit) Ocu-Mir-181-P1b_5p (mature (guide))
  36. Otolemur garnettii (small-eared galago) oga-miR-181a
  37. Ovis aries oar-miR-181a
  38. Pan paniscus (pygmy chimpanzee) ppa-miR-181a-5p
  39. Pan troglodytes ptr-miR-181a-5p
  40. Papio hamadryas pha-miR-181a
  41. Petromyzon marinus (sea lamprey) pma-miR-181a-5p
  42. Pongo pygmaeus (Bornean orangutan) ppy-miR-181a-5p
  43. Python bivittatus Pbv-Mir-181-P1c_5p (mature (guide))
  44. Rattus norvegicus rno-miR-181a-5p
  45. Saguinus labiatus sla-miR-181a
  46. Salmo salar (Atlantic salmon) ssa-miR-181a-5p
  47. Sarcophilus harrisii Sha-Mir-181-P1b_5p (mature (guide))
  48. Scyliorhinus torazame (cloudy catshark) Sto-Mir-181-P1b_5p (mature (guide))
  49. Sphenodon punctatus Spt-Mir-181-P1b_5p (mature (guide))
  50. Taeniopygia guttata (zebra finch) tgu-miR-181a-5p
  51. Takifugu rubripes (torafugu) fru-miR-181a-5p
  52. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-181a-5p
  53. Tor tambroides (Thai mahseer) miR-181a-5p
  54. Tupaia chinensis tch-miR-181a-5p
  55. Xenopus tropicalis xtr-miR-181a-5p
Publications