Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-181a-5p URS00003DA300_10090

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Mus musculus. Annotated by 8 databases (IntAct, PirBase, LncBase, TarBase, RefSeq, miRBase, ENA, MirGeneDB). Described in 63 papers. Mus musculus (house mouse) mmu-miR-181a-5p sequence is a product of mmu-miR-181a-5p, 181, miR-181a, Mir181a-1, Mir181a-2, mmu-miR-181a, miR-181, miR-181a-5p genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 0610007D13Rik, 0610009F02Rik, 0610009M14Rik, 0610010K06Rik, 0610010O12Rik, 0610011E17Rik, 0610011L14Rik, 0610011N22Rik, 0610012A05Rik, 0610020I02Rik.

Interactions 1

According to IntAct, Mus musculus (house mouse) mmu-miR-181a-5p interacts with:

IntAct ID Participant Synonyms
EBI-20770779 intact:EBI-20770760 EBI-20770760 ENSMUST00000206720.1 mrna_cbl

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AACAUUCAACGCUGUCGGUGAGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 46 other species

    1. Alligator mississippiensis (American alligator) ami-miR-181a-5p
    2. Anolis carolinensis (green anole) aca-miR-181a
    3. Bos taurus Bta-Mir-181-P1b_5p (mature (guide))
    4. Callithrix jacchus cja-miR-181a
    5. Callorhinchus milii eshark_mir-181_4
    6. Canis lupus familiaris Cfa-Mir-181-P1b_5p (mature (guide))
    7. Capra hircus miR-181a
    8. Cavia porcellus (domestic guinea pig) Cpo-Mir-181-P1b_5p (mature (guide))
    9. Cervus elaphus (red deer) cel-miR-181a
    10. Chrysemys picta bellii Cpi-Mir-181-P1b_5p (mature (guide))
    11. Chrysemys picta cpi-miR-181a-5p
    12. Columba livia (rock pigeon) Cli-Mir-181-P1b_5p (mature (guide))
    13. Cricetulus griseus cgr-miR-181a-5p
    14. Danio rerio (zebrafish) dre-miR-181a-5p
    15. Dasypus novemcinctus Dno-Mir-181-P1b_5p (mature (guide))
    16. Daubentonia madagascariensis dma-miR-181a
    17. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-181-P1b_5p (mature (guide))
    18. Equus caballus (horse) eca-miR-181a
    19. Gadus morhua gmo-miR-181a-5p
    20. Gallus gallus (chicken) gga-miR-181a-5p
    21. Gorilla gorilla ggo-miR-181a-5p
    22. Homo sapiens (human) hsa-miR-181a-5p
    23. Lagothrix lagotricha lla-miR-181a-5p
    24. Macaca mulatta (Rhesus monkey) mml-miR-181a-5p
    25. Macaca nemestrina mne-miR-181a-5p
    26. Monodelphis domestica mdo-miR-181a-5p
    27. Nomascus leucogenys nle-miR-181a
    28. Ornithorhynchus anatinus oan-miR-181a-5p
    29. Oryctolagus cuniculus Ocu-Mir-181-P1b_5p (mature (guide))
    30. Otolemur garnettii (small-eared galago) oga-miR-181a
    31. Ovis aries oar-miR-181a
    32. Pan paniscus ppa-miR-181a-5p
    33. Pan troglodytes (chimpanzee) ptr-miR-181a-5p
    34. Papio hamadryas (hamadryas baboon) pha-miR-181a
    35. Petromyzon marinus pma-miR-181a-5p
    36. Pongo pygmaeus (Bornean orangutan) ppy-miR-181a-5p
    37. Rattus norvegicus rno-miR-181a-5p
    38. Saguinus labiatus (red-chested mustached tamarin) sla-miR-181a
    39. Salmo salar (Atlantic salmon) ssa-miR-181a-5p
    40. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-181-P1b_5p (mature (guide))
    41. Scyliorhinus torazame Sto-Mir-181-P1b_5p (mature (guide))
    42. Taeniopygia guttata tgu-miR-181a-5p
    43. Takifugu rubripes (torafugu) fru-miR-181a-5p
    44. Tetraodon nigroviridis tni-miR-181a-5p
    45. Tor tambroides (Thai mahseer) miR-181a-5p
    46. Tupaia chinensis (Chinese tree shrew) tch-miR-181a-5p
    47. Xenopus tropicalis xtr-miR-181a-5p