Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Arabidopsis lyrata (lyrate rockcress) aly-miR396a-5p URS000039FDDC_59689

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

aly-miR396a-5p: Aly-mir396a-5p is a microRNA (miRNA) found in ginger exosome-like nanoparticle (GELNs) and is present in the tissues of edible plants [PMC10047465]. GDLVs encapsulating aly-mir396a-5p have been shown to inhibit the expression of Nsp12 and spike genes, which are involved in SARS-CoV-2-induced cytopathic effect [PMC9338735]. Aly-mir396a-5p, when delivered to the lung, effectively inhibits lung inflammation [PMC9338735]. Researchers have developed GELN microRNA aly-mir396a-5p to alleviate lung inflammation [PMC9941074]. Ginger-derived extracellular vesicles (EVs) containing aly-mir396a-5p have been found to inhibit NF-κB-mediated inflammation and apoptosis in the lungs of mice [PMC9028404]. The transfection efficiency of nanovectors loaded with aly-mir396a-5p is higher than ginger-derived nanovesicles or polyethylenimine but lower than RNAiMAX in A549 cells [PMC9319657]. Aly-mir396a-5p, derived from plants, specifically inhibits viral gene expression without affecting host genes and could be utilized for developing miRNA therapeutics [PMC8619171]. Ginger exosomal miRNAs, including aly-mir396a-5p, can impede SARS-CoV-2 replication by restricting the expression of specific viral proteins such as spike protein and RNA polymerase Nsp12 [PMC8590742]. Aly-mir396a-5p packed into GDVs prevents inflammatory response caused by EVs from lung epithelial cells by inhibiting viral Nsp12 gene expression [PMC10053153]. Plant-derived miRNAs like aly-mir396a-5p do not disturb the body's immune response and specifically inhibit the expression of nonstructural and spike proteins [PMC9249409]. Aly-mir396a-5p inhibits inflammation and cell apoptosis by inhibiting the expression of the viral Nsp12 gene [PMC9231591]. Aly-mir396a-5p delivered by GNVs reduces viral gene expression and prevents NF-κB activation and lung epithelial cell apoptosis [PMC8110335]. GNVs carrying aly-mir396a-5p inhibit the expression of inflammatory cytokines induced by Nsp12 of SARS-CoV-2 [PMC8110335]. GELN aly-mir396a-5p treatment prevents exosomesNsp12Nsp13-mediated NF-κB activation and lung epithelial cell apoptosis [PMC8110335]. Aly-mir396a-5p packed in GNVs inhibits viral gene expression, reduces inflammatory cytokines, and improves pulmonary inflammation caused by exosomesNsp12Nsp13 [PMC8110335].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCCACAGCUUUCUUGAACUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 41 other species

  1. Acacia auriculiformis aau-miR396
  2. Acacia mangium amg-miR396
  3. Aegilops tauschii ata-miR396e-5p
  4. Ananas comosus (pineapple) vvi-miR396d
  5. Aquilegia coerulea (Rocky Mountain columbine) aqc-miR396a
  6. Arabidopsis thaliana ath-miR396a-5p
  7. Asparagus officinalis aof-miR396b
  8. Brachypodium distachyon bdi-miR396d-5p
  9. Bruguiera cylindrica bcy-miR396a
  10. Bruguiera gymnorhiza (Burma mangrove) bgy-miR396a
  11. Camelina sativa (false flax) cas-miR396a
  12. Carica papaya cpa-miR396
  13. Citrus sinensis (sweet orange) csi-miR396b-5p
  14. Cucumis melo (muskmelon) cme-miR396b
  15. Digitalis purpurea dpr-miR396
  16. Eugenia uniflora (Brazil-cherry) eun-miR396b-5p
  17. Fragaria vesca subsp. vesca fve-miR396c-5p
  18. Glycine max gma-miR396i-5p
  19. Gossypium hirsutum (cotton) ghr-miR396b
  20. Helianthus annuus ath-miR396a-5p
  21. Hevea brasiliensis hbr-miR396b
  22. Linum usitatissimum (flax) lus-miR396a
  23. Lotus japonicus lja-miR396
  24. Malus domestica (apple) mdm-miR396b
  25. Manihot esculenta mes-miR396b
  26. Medicago truncatula mtr-miR396b-5p
  27. Nicotiana attenuata microRNA mir-396-like
  28. Nicotiana tabacum (common tobacco) nta-miR396a
  29. Oryza sativa (Asian cultivated rice) osa-miR396b-5p
  30. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR396b-5p
  31. Populus tomentosa Pto-miR396b
  32. Populus trichocarpa (black cottonwood) ptc-miR396b
  33. Rosa chinensis ath-miR396a-5p
  34. Saccharum officinarum (sugarcane) sof-miR396
  35. Saccharum sp. ssp-miR396
  36. Salvia sclarea (clary) ssl-miR396
  37. Solanum lycopersicum sly-miR396a-5p
  38. Sorghum bicolor sbi-miR396a
  39. Theobroma cacao (cacao) tcc-miR396a
  40. Vitis vinifera vvi-miR396c
  41. Zea mays (maize) zma-miR396a-5p
Publications