Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Solanum lycopersicum (tomato) sly-miR396a-5p URS000039FDDC_4081

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

sly-miR396a-5p: Sly-mir396a-5p is a circular RNA (circRNA) that has been identified as a potential salt-responsive circRNA and functions as a miRNA sponge by binding to sly-mir396a-5p and sly-miR396b, which in turn regulate the expression of Solyc04g025530.3 (glutamate decarboxylase 4) [PMC8625345]. Additionally, sly-mir396a-5p and sly-miR396b have been found to be down-regulated in the drought-tolerant genotype IL9-1, while they are up-regulated in the sensitive genotype M82 after drought stress [PMC5485680]. These miRNAs, including sly-mir396a-5p, show differential expression between the two genotypes [PMC5485680]. Sly-mir396a-5p has been identified as targeting GRF3, GRF4, and GRF8 genes [PMC7060562]. Furthermore, sly-mir396a-5p is among several miRNAs that regulate abiotic stress tolerance in tomato by targeting members of the SlHVA22 gene family [PMC9602767]. Additionally, it has been found that several tomato miRNAs including sly-mir396a-5p are involved in the development and stress response of tomato by targeting PLATZ genes [PMC9697139]. Specifically, sly-mir396a-5p and sly-miR396b have been implicated in drought stress response in tomato [PMC9697139].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCCACAGCUUUCUUGAACUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 41 other species

  1. Acacia auriculiformis aau-miR396
  2. Acacia mangium amg-miR396
  3. Aegilops tauschii ata-miR396e-5p
  4. Ananas comosus (pineapple) vvi-miR396d
  5. Aquilegia coerulea (Rocky Mountain columbine) aqc-miR396a
  6. Arabidopsis lyrata (lyrate rockcress) aly-miR396a-5p
  7. Arabidopsis thaliana ath-miR396a-5p
  8. Asparagus officinalis aof-miR396b
  9. Brachypodium distachyon bdi-miR396d-5p
  10. Bruguiera cylindrica bcy-miR396a
  11. Bruguiera gymnorhiza (Burma mangrove) bgy-miR396a
  12. Camelina sativa (false flax) cas-miR396a
  13. Carica papaya cpa-miR396
  14. Citrus sinensis (sweet orange) csi-miR396b-5p
  15. Cucumis melo (muskmelon) cme-miR396b
  16. Digitalis purpurea dpr-miR396
  17. Eugenia uniflora (Brazil-cherry) eun-miR396b-5p
  18. Fragaria vesca subsp. vesca fve-miR396c-5p
  19. Glycine max gma-miR396i-5p
  20. Gossypium hirsutum (cotton) ghr-miR396b
  21. Helianthus annuus ath-miR396a-5p
  22. Hevea brasiliensis hbr-miR396b
  23. Linum usitatissimum (flax) lus-miR396a
  24. Lotus japonicus lja-miR396
  25. Malus domestica (apple) mdm-miR396b
  26. Manihot esculenta mes-miR396b
  27. Medicago truncatula mtr-miR396b-5p
  28. Nicotiana attenuata microRNA mir-396-like
  29. Nicotiana tabacum (common tobacco) nta-miR396a
  30. Oryza sativa (Asian cultivated rice) osa-miR396b-5p
  31. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR396b-5p
  32. Populus tomentosa Pto-miR396b
  33. Populus trichocarpa (black cottonwood) ptc-miR396b
  34. Rosa chinensis ath-miR396a-5p
  35. Saccharum officinarum (sugarcane) sof-miR396
  36. Saccharum sp. ssp-miR396
  37. Salvia sclarea (clary) ssl-miR396
  38. Sorghum bicolor sbi-miR396a
  39. Theobroma cacao (cacao) tcc-miR396a
  40. Vitis vinifera vvi-miR396c
  41. Zea mays (maize) zma-miR396a-5p
Publications