Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa (Asian cultivated rice) osa-miR396b-5p URS000039FDDC_4530

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

osa-miR396a-5p: Osa-mir396a-5p is a specific type of small RNA molecule that is mainly expressed in panicles [PMC6167770]. It has been identified as a differential molecule with differential regulations or networks in tillers [PMC5981461]. In a study, it was found that the lncRNA MSTRG.52515.5 acts as an eTM (endogenous target mimic) that interferes with the interaction between osa-mir396a-5p and its target genes OsGRF10 and OsGRF6 [PMC7840536]. Another study identified MSTRG.52515.5 as a potential eTM for osa-mir396a-5p in ceRNA networks prediction [PMC7840536]. It was also observed that osa-mir396a-5p has a similar mature sequence to osamiR821a, osamiR821b, and osamiR821c, but they have different stem loop sequences [PMC3819571]. In the same study, it was predicted that osa-mir396a-5p is one of the submergence-responsive miRNAs expressed during submergence [PMC3819571]. Additionally, during coleoptile senescence, osa-mir396a-5p was highly upregulated (>4-fold) along with other conserved miRNAs such as osamiR160e-5p and osamiR531a [PMC9597502]. In summary, osa-mir396a-5p is an important small RNA molecule expressed in panicles and involved in various regulatory networks. It has been found to have differential regulations and interactions with target genes. Additionally, it plays a role in submergence response and senescence processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCCACAGCUUUCUUGAACUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 41 other species

  1. Acacia auriculiformis aau-miR396
  2. Acacia mangium amg-miR396
  3. Aegilops tauschii ata-miR396e-5p
  4. Ananas comosus (pineapple) vvi-miR396d
  5. Aquilegia coerulea (Rocky Mountain columbine) aqc-miR396a
  6. Arabidopsis lyrata (lyrate rockcress) aly-miR396a-5p
  7. Arabidopsis thaliana ath-miR396a-5p
  8. Asparagus officinalis aof-miR396b
  9. Brachypodium distachyon bdi-miR396d-5p
  10. Bruguiera cylindrica bcy-miR396a
  11. Bruguiera gymnorhiza (Burma mangrove) bgy-miR396a
  12. Camelina sativa (false flax) cas-miR396a
  13. Carica papaya cpa-miR396
  14. Citrus sinensis (sweet orange) csi-miR396b-5p
  15. Cucumis melo (muskmelon) cme-miR396b
  16. Digitalis purpurea dpr-miR396
  17. Eugenia uniflora (Brazil-cherry) eun-miR396b-5p
  18. Fragaria vesca subsp. vesca fve-miR396c-5p
  19. Glycine max gma-miR396i-5p
  20. Gossypium hirsutum (cotton) ghr-miR396b
  21. Helianthus annuus ath-miR396a-5p
  22. Hevea brasiliensis hbr-miR396b
  23. Linum usitatissimum (flax) lus-miR396a
  24. Lotus japonicus lja-miR396
  25. Malus domestica (apple) mdm-miR396b
  26. Manihot esculenta mes-miR396b
  27. Medicago truncatula mtr-miR396b-5p
  28. Nicotiana attenuata microRNA mir-396-like
  29. Nicotiana tabacum (common tobacco) nta-miR396a
  30. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR396b-5p
  31. Populus tomentosa Pto-miR396b
  32. Populus trichocarpa (black cottonwood) ptc-miR396b
  33. Rosa chinensis ath-miR396a-5p
  34. Saccharum officinarum (sugarcane) sof-miR396
  35. Saccharum sp. ssp-miR396
  36. Salvia sclarea (clary) ssl-miR396
  37. Solanum lycopersicum sly-miR396a-5p
  38. Sorghum bicolor sbi-miR396a
  39. Theobroma cacao (cacao) tcc-miR396a
  40. Vitis vinifera vvi-miR396c
  41. Zea mays (maize) zma-miR396a-5p
Publications