Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Aegilops tauschii ata-miR396e-5p URS000039FDDC_37682

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ata-miR396e-5p: Ata-mir396e-5p is a member of the miR396 family and is relatively abundant during the early stages of grain development, suggesting its involvement in this process [PMC7045451]. The encoded proteins of the target genes regulated by ata-mir396e-5p are involved in various functions, including response to gibberellin, transcriptional regulation, GTPase activity, and protein kinase activity [PMC7045451]. Other miRNAs that are relatively abundant during early stages of development include osa-miR171a, ata-miR172c-3p, ata-miR393-5p_L-1R + 1, and ata-miR5168-3p [PMC7045451]. The target genes of bdi-miR531_L-4R + 1_1ss5CT and ata-mir396e-5p are involved in cysteine and methionine metabolism according to KEGG pathway analysis [PMC7045451]. Degradome analysis revealed that ata-mir396e-5p is associated with 46 target genes including auxin response factors and growth-regulating factors [PMC6069884]. In a study comparing different stresses, ata-mir396e-5p was found to be one of the six miRNAs that responded commonly to all three stresses [PMC8704135]. In XZ29 variety, osa-miR319a-3p was upregulated while ata-miR396a-5p and ata-mir396e-5p were downregulated [PMC6069884]. Overall, these findings highlight the importance of miRNAs like ata-mir396e-5p in grain development and stress response.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCCACAGCUUUCUUGAACUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 41 other species

  1. Acacia auriculiformis aau-miR396
  2. Acacia mangium amg-miR396
  3. Ananas comosus (pineapple) vvi-miR396d
  4. Aquilegia coerulea (Rocky Mountain columbine) aqc-miR396a
  5. Arabidopsis lyrata (lyrate rockcress) aly-miR396a-5p
  6. Arabidopsis thaliana ath-miR396a-5p
  7. Asparagus officinalis aof-miR396b
  8. Brachypodium distachyon bdi-miR396d-5p
  9. Bruguiera cylindrica bcy-miR396a
  10. Bruguiera gymnorhiza (Burma mangrove) bgy-miR396a
  11. Camelina sativa (false flax) cas-miR396a
  12. Carica papaya cpa-miR396
  13. Citrus sinensis (sweet orange) csi-miR396b-5p
  14. Cucumis melo (muskmelon) cme-miR396b
  15. Digitalis purpurea dpr-miR396
  16. Eugenia uniflora (Brazil-cherry) eun-miR396b-5p
  17. Fragaria vesca subsp. vesca fve-miR396c-5p
  18. Glycine max gma-miR396i-5p
  19. Gossypium hirsutum (cotton) ghr-miR396b
  20. Helianthus annuus ath-miR396a-5p
  21. Hevea brasiliensis hbr-miR396b
  22. Linum usitatissimum (flax) lus-miR396a
  23. Lotus japonicus lja-miR396
  24. Malus domestica (apple) mdm-miR396b
  25. Manihot esculenta mes-miR396b
  26. Medicago truncatula mtr-miR396b-5p
  27. Nicotiana attenuata microRNA mir-396-like
  28. Nicotiana tabacum (common tobacco) nta-miR396a
  29. Oryza sativa (Asian cultivated rice) osa-miR396b-5p
  30. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR396b-5p
  31. Populus tomentosa Pto-miR396b
  32. Populus trichocarpa (black cottonwood) ptc-miR396b
  33. Rosa chinensis ath-miR396a-5p
  34. Saccharum officinarum (sugarcane) sof-miR396
  35. Saccharum sp. ssp-miR396
  36. Salvia sclarea (clary) ssl-miR396
  37. Solanum lycopersicum sly-miR396a-5p
  38. Sorghum bicolor sbi-miR396a
  39. Theobroma cacao (cacao) tcc-miR396a
  40. Vitis vinifera vvi-miR396c
  41. Zea mays (maize) zma-miR396a-5p
Publications