Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) Nc-gga-miR-133a* microRNA URS0000383E7F_9031

Automated summary: This misc RNA sequence is 22 nucleotides long and is found in Gallus gallus. Annotated by 1 database (ENA). Found in the Gallus gallus reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AGCUGGUAAAAUGGAACCAAAU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 17 other species

    1. Alligator mississippiensis (American alligator) ami-miR-133a-5p
    2. Anolis carolinensis Aca-Mir-133-P1-v2_5p* (star (passenger))
    3. Bos taurus (cattle) Bta-Mir-133-P1-v2_5p* (star (passenger))
    4. Canis lupus familiaris Cfa-Mir-133-P1-v2_5p* (star (passenger))
    5. Capra hircus (goat) chi-miR-133a-5p
    6. Cavia porcellus (domestic guinea pig) Cpo-Mir-133-P1-v2_5p* (star (passenger))
    7. Chiloscyllium plagiosum microRNA cpl-miR-133-5p
    8. Chrysemys picta bellii Cpi-Mir-133-P1-v2_5p* (star (passenger))
    9. Chrysemys picta (Painted turtle) cpi-miR-133a-5p
    10. Columba livia (rock pigeon) Cli-Mir-133-P1-v2_5p* (star (passenger))
    11. Danio rerio (zebrafish) dre-miR-133a-5p
    12. Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-133-P1-v2_5p* (star (passenger))
    13. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-133-P2-v2_5p* (star (passenger))
    14. Gadus morhua (Atlantic cod) gmo-miR-133a-5p
    15. Homo sapiens (human) hsa-miR-133a-5p
    16. Macaca mulatta mml-miR-133c-5p
    17. Monodelphis domestica mdo-miR-133a-1-5p
    18. Mus musculus Mus_musculus piRNA piR-mmu-49145126
    19. Ornithorhynchus anatinus (platypus) oan-miR-133a-5p
    20. Oryctolagus cuniculus (rabbit) Ocu-Mir-133-P2-v2_5p* (star (passenger))
    21. Pteropus alecto pal-miR-133a-5p
    22. Python bivittatus (Burmese python) pbv-miR-133a-5p
    23. Rattus norvegicus rno-miR-133a-5p
    24. Sarcophilus harrisii Sha-Mir-133-P2-v2_5p* (star (passenger))
    25. Scyliorhinus torazame (cloudy catshark) Sto-Mir-133-P1-v2_5p* (star (passenger))
    26. Sus scrofa (pig) ssc-miR-133a-5p
    27. Taeniopygia guttata tgu-miR-133-5p
    28. Tor tambroides miR-133a-5p
    29. Xenopus tropicalis Xtr-Mir-133-P1-v2_5p* (star (passenger))