Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-133a-5p URS0000383E7F_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-133a: ssc-mir-133a is a microRNA that was found to be overexpressed in L samples in a bioinformatic screening [PMC5155628]. It was selected as a candidate for further experimental validation due to its role in reproductive-related pathways [PMC5155628]. Significant correlations were found between the expression level of ssc-mir-133a and validated differentially expressed genes related to prolificacy [PMC5155628]. ssc-mir-133a was also found to be up-regulated in the adipose tissue of Laiwu pigs and is related to adipocyte differentiation and fat metabolism [PMC9859024]. In addition, ssc-mir-133a may play a role in premolar morphogenesis, as it is differentially expressed during premolar development and may be involved in multiple pathways related to bicuspid teeth morphogenesis [PMC4696248]. It was also found to play a more important role in the early morphogenesis of premolars compared to other microRNAs [PMC4696248]. Overall, ssc-mir-133a has been implicated in reproductive-related pathways, adipocyte differentiation, fat metabolism, and premolar morphogenesis.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCUGGUAAAAUGGAACCAAAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Alligator mississippiensis (American alligator) ami-miR-133a-5p
  2. Capra hircus chi-miR-133a-5p
  3. Chiloscyllium plagiosum microRNA cpl-miR-133-5p
  4. Chrysemys picta (Painted turtle) cpi-miR-133a-5p
  5. Danio rerio dre-miR-133a-5p
  6. Gadus morhua gmo-miR-133a-5p
  7. Gallus gallus (chicken) Nc-gga-miR-133a* microRNA
  8. Homo sapiens hsa-miR-133a-5p
  9. Macaca mulatta (Rhesus monkey) mml-miR-133c-5p
  10. Monodelphis domestica mdo-miR-133a-1-5p
  11. Mus musculus Mus_musculus piRNA piR-mmu-49145126
  12. Ornithorhynchus anatinus (platypus) oan-miR-133a-5p
  13. Pteropus alecto (black flying fox) pal-miR-133a-5p
  14. Python bivittatus pbv-miR-133a-5p
  15. Rattus norvegicus rno-miR-133a-5p
  16. Taeniopygia guttata tgu-miR-133-5p
  17. Tor tambroides (Thai mahseer) miR-133a-5p
Publications