Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-133a-5p URS0000383E7F_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-133a: Rno-mir-133a is a downregulated miRNA [PMC8315965]. It is one of the miRNAs that share target proteins with the upregulated miRNAs, suggesting complex regulation of these proteins in vivo [PMC8315965]. In an experiment, NRCMs were transfected with the Pre-miRâ„¢ rno-mir-133a precursor [PMC3823095]. Primers were designed specifically for rno-mir-133a [PMC9695087]. The seed sequence for rno-mir-133a was found to be conserved between rat, mouse, and human [PMC3514786]. AMOs targeting rno-mir-133a were synthesized [PMC3066105]. Rno-mir-133a is one of the miRNAs that may repress the expression of negative modulators in a specific context [PMC5920094]. It has been associated with muscle damage along with rno-miR-1 and rno-mir-133b [PMC8933690]. Rno-miR-100, rno-mir-133a, rno-miR-133b, and rno-miR-466c were consistently detected in plasma samples in a microarray screening experiment [PMC4198680]. The expression of both rno-mir-133a and rno-miR-133b was increased in plasma samples after certain conditions with significant fold changes observed for both miRNAs [PMC4198680].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCUGGUAAAAUGGAACCAAAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Alligator mississippiensis (American alligator) ami-miR-133a-5p
  2. Capra hircus chi-miR-133a-5p
  3. Chiloscyllium plagiosum microRNA cpl-miR-133-5p
  4. Chrysemys picta (Painted turtle) cpi-miR-133a-5p
  5. Danio rerio dre-miR-133a-5p
  6. Gadus morhua gmo-miR-133a-5p
  7. Gallus gallus (chicken) Nc-gga-miR-133a* microRNA
  8. Homo sapiens hsa-miR-133a-5p
  9. Macaca mulatta (Rhesus monkey) mml-miR-133c-5p
  10. Monodelphis domestica mdo-miR-133a-1-5p
  11. Mus musculus Mus_musculus piRNA piR-mmu-49145126
  12. Ornithorhynchus anatinus (platypus) oan-miR-133a-5p
  13. Pteropus alecto (black flying fox) pal-miR-133a-5p
  14. Python bivittatus pbv-miR-133a-5p
  15. Sus scrofa (pig) ssc-miR-133a-5p
  16. Taeniopygia guttata tgu-miR-133-5p
  17. Tor tambroides (Thai mahseer) miR-133a-5p
Publications