Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Capra hircus (goat) chi-miR-133a-5p URS0000383E7F_9925

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCUGGUAAAAUGGAACCAAAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Alligator mississippiensis (American alligator) ami-miR-133a-5p
  2. Chiloscyllium plagiosum microRNA cpl-miR-133-5p
  3. Chrysemys picta (Painted turtle) cpi-miR-133a-5p
  4. Danio rerio dre-miR-133a-5p
  5. Gadus morhua gmo-miR-133a-5p
  6. Gallus gallus (chicken) Nc-gga-miR-133a* microRNA
  7. Homo sapiens hsa-miR-133a-5p
  8. Macaca mulatta (Rhesus monkey) mml-miR-133c-5p
  9. Monodelphis domestica mdo-miR-133a-1-5p
  10. Mus musculus Mus_musculus piRNA piR-mmu-49145126
  11. Ornithorhynchus anatinus (platypus) oan-miR-133a-5p
  12. Pteropus alecto (black flying fox) pal-miR-133a-5p
  13. Python bivittatus pbv-miR-133a-5p
  14. Rattus norvegicus rno-miR-133a-5p
  15. Sus scrofa (pig) ssc-miR-133a-5p
  16. Taeniopygia guttata tgu-miR-133-5p
  17. Tor tambroides (Thai mahseer) miR-133a-5p
Publications