v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Chiloscyllium punctatum (brownbanded bambooshark) tRNA secondary structure diagram

Chiloscyllium punctatum (brownbanded bambooshark) tRNA URS000035EE7E_137246

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGUCCCAUGGUGUAAUGGUUAGCACUCUGGACUUUGAAUCCAGCGAUCCGAGUUCAAAUCUCGGUGGGACCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 718 other species

  1. Acanthochromis polyacanthus tRNA
  2. Accipiter nisus (Eurasian sparrowhawk) tRNA
  3. Acinonyx jubatus (cheetah) tRNA
  4. Acipenser ruthenus (sterlet) tRNA
  5. Acrocephalus arundinaceus (great reed warbler) tRNA
  6. Acromyrmex charruanus tRNA
  7. Acromyrmex echinatior tRNA-Gln
  8. Acromyrmex heyeri tRNA
  9. Acropora cervicornis tRNA-Gln
  10. Acropora millepora (Stony coral) tRNA-Gln
  11. Adelges cooleyi (Spruce gall adelgid) transfer RNA glutamine (anticodon UUG)
  12. Aegithalos caudatus tRNA
  13. Aegotheles bennettii tRNA
  14. Agrilus planipennis tRNA-Gln
  15. Ailuropoda melanoleuca tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  16. Albula glossodonta (roundjaw bonefish) tRNA
  17. Albula goreensis tRNA
  18. Alligator mississippiensis tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  19. Alligator sinensis (Chinese alligator) tRNA
  20. Amazona aestiva tRNA
  21. Amazona collaria (yellow-billed parrot) tRNA
  22. Amazona guildingii tRNA
  23. Amblyteles armatorius (Ichneumon Wasp) misc RNA ENSAAYG00000011492.1
  24. Ameca splendens tRNA-Gln
  25. Ameiurus melas tRNA
  26. Amphiprion ocellaris (clown anemonefish) tRNA
  27. Amphiprion percula tRNA
  28. Amyelois transitella (Moths) transfer RNA glutamine (anticodon UUG)
  29. Anabarilius grahami tRNA
  30. Anabas testudineus tRNA
  31. Anas platyrhynchos platyrhynchos (common mallard) tRNA
  32. Anas zonorhyncha tRNA
  33. Ancistrocerus nigricornis (Potter wasp) misc RNA ENSANRG00000003640.1
  34. Anguilla anguilla (European eel) tRNA
  35. Anniella stebbinsi tRNA-Gln
  36. Anolis carolinensis tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  37. Anoplophora glabripennis (Asian long-horned beetle) tRNA-Gln
  38. Anseranas semipalmata (magpie goose) tRNA
  39. Anser brachyrhynchus (pink-footed goose) tRNA
  40. Anser cygnoides (Chinese goose) tRNA
  41. Anthoscopus minutus tRNA
  42. Aotus nancymaae (Ma's night monkey) tRNA
  43. Aphelocoma coerulescens (scrub jay) tRNA
  44. Apis cerana cerana tRNA
  45. Apis dorsata tRNA-Gln
  46. Apis florea tRNA-Gln
  47. Apis mellifera tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1, tRNA-Gln-TTG-2-2)
  48. Aplysia californica tRNA-Gln (TTG) (tRNA-Gln-TTG-1 1 to 10)
  49. Apteryx mantelli mantelli Apteryx australis mantelli tRNA
  50. Apteryx owenii (little spotted kiwi) tRNA
  51. Aquila chrysaetos chrysaetos tRNA
  52. Arctogadus glacialis (Arctic cod) tRNA-Gln
  53. Ardeotis kori tRNA
  54. Arenaria interpres (ruddy turnstone) tRNA
  55. Aromia moschata tRNA-Gln
  56. Asarcornis scutulata tRNA
  57. Asbolus verrucosus (desert ironclad beetle) tRNA
  58. Astyanax mexicanus tRNA
  59. Ataeniobius toweri tRNA-Gln
  60. Athalia rosae misc RNA ENSAEAG00005004799.1
  61. Atlantisia rogersi (inaccessible island rail) tRNA
  62. Atractosteus spatula (alligator gar) tRNA
  63. Atrichornis clamosus tRNA
  64. Atta cephalotes (Leaf-cutter ant) tRNA LOC105616953-2
  65. Atta colombica tRNA
  66. Austrofundulus limnaeus tRNA
  67. Aythya fuligula (tufted duck) tRNA
  68. Bagarius yarrelli (goonch) tRNA
  69. Balaeniceps rex (shoebill) tRNA
  70. Balaenoptera acutorostrata scammoni tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  71. Balaenoptera musculus (Blue whale) tRNA
  72. Bambusicola thoracicus Bambusicola thoracica (Chinese bamboo-partridge) tRNA
  73. Baryphthengus martii tRNA
  74. Betta splendens (Siamese fighting fish) tRNA
  75. Bicyclus anynana (squinting bush brown) misc RNA ENSINYG00000026504.1
  76. Biomphalaria glabrata tRNA
  77. Biomphalaria pfeifferi tRNA-Gln
  78. Bison bison bison (north american plains bison) tRNA
  79. Blattella germanica tRNA-Gln (TTG) (tRNA-Gln-TTG-1 1 to 11)
  80. Bombus affinis (Rusty patched bumble bee) transfer RNA glutamine (anticodon UUG)
  81. Bombus huntii (Hunt's bumblebee) transfer RNA glutamine (anticodon UUG)
  82. Bombus impatiens (Common eastern bumblebee) tRNA-Gln
  83. Bombus terrestris (Bombus terrestris) misc RNA ENSBTSG00005036439.1
  84. Bombus vancouverensis nearcticus (Montane Bumble Bee) tRNA-Gln
  85. Bombus vosnesenskii tRNA
  86. Bombycilla garrulus tRNA
  87. Bombyx mandarina (Wild silkworm) tRNA-Gln
  88. Bombyx mori tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  89. Boreogadus saida tRNA-Gln
  90. Bos grunniens (domestic yak) tRNA
  91. Bos mutus Bos grunniens mutus tRNA
  92. Bos indicus tRNA
  93. Bos indicus x Bos taurus (hybrid cattle) tRNA
  94. Bos taurus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  95. Brachypteracias leptosomus (short-legged ground-roller) tRNA
  96. Branchiostoma belcheri (Belcher's lancelet) tRNA
  97. Branchiostoma floridae tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  98. Branchiostoma lanceolatum (Amphioxus) transfer RNA glutamine (anticodon UUG)
  99. Brenthis ino (lesser marbled fritillary) tRNA
  100. Bucco capensis (collared puffbird) tRNA
  101. Bucorvus abyssinicus tRNA
  102. Buphagus erythrorhynchus (red-billed oxpecker) tRNA
  103. Burhinus bistriatus tRNA
  104. Cairina moschata domestica (muscovy duck (domestic type)) tRNA
  105. Alaudala cheleensis Calandrella cheleensis tRNA
  106. Calcarius ornatus tRNA
  107. Callaeas wilsoni (north island kokako) tRNA
  108. Callipepla squamata tRNA
  109. Callithrix jacchus tRNA-Gln (TTG) (tRNA-Gln-TTG-4-1)
  110. Callorhinchus milii tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  111. Callorhinus ursinus (northern fur seal) tRNA
  112. Caloenas nicobarica tRNA
  113. Calypte anna (Anna's hummingbird) tRNA
  114. Camarhynchus parvulus tRNA
  115. Camelus bactrianus (Bactrian camel) tRNA
  116. Camelus dromedarius (Arabian camel) tRNA
  117. Camelus ferus tRNA
  118. Camponotus floridanus tRNA-Gln
  119. Campylorhamphus procurvoides tRNA
  120. Candidula unifasciata tRNA
  121. Canis lupus dingo (dingo) tRNA
  122. Canis lupus familiaris tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  123. Capra hircus (goat) tRNA
  124. Caranx melampygus tRNA-OTHER
  125. Carassius auratus (goldfish) tRNA
  126. Cardinalis cardinalis tRNA
  127. Carlito syrichta tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  128. Castor canadensis (American beaver) tRNA
  129. Cataglyphis hispanica (Desert ant) transfer RNA glutamine (anticodon UUG)
  130. Catagonus wagneri (Chacoan peccary) tRNA
  131. Catharus fuscescens tRNA
  132. Catharus ustulatus tRNA
  133. Cavia porcellus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1, tRNA-Gln-TTG-1-2)
  134. Sapajus apella Cebus apella (Tufted capuchin) tRNA
  135. Cebus imitator (Panamanian white-faced capuchin) tRNA
  136. Centropus unirufus tRNA
  137. Centruroides sculpturatus (Bark scorpion) tRNA-Gln
  138. Cephus cinctus (wheat stem sawfly) tRNA
  139. Cepphus grylle tRNA
  140. Ceratotherium simum simum tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  141. Cercocebus atys (sooty mangabey) tRNA
  142. Tychaedon coryphoeus Cercotrichas coryphoeus (Karoo scrub-robin) tRNA
  143. Cervus elaphus hippelaphus tRNA
  144. Cervus hanglu yarkandensis Cervus elaphus yarkandensis tRNA
  145. Cettia cetti tRNA
  146. Ceuthmochares aereus tRNA
  147. Chaetorhynchus papuensis (pygmy drongo) tRNA
  148. Channa argus (snakehead) tRNA
  149. Chanos chanos (milkfish) tRNA
  150. Characodon lateralis tRNA-Gln
  151. Chauna torquata (southern screamer) tRNA
  152. Chelonia mydas (green seaturtle) tRNA
  153. Chelonus insularis tRNA-Gln
  154. Chelydra serpentina (snapping turtle) tRNA
  155. Chinchilla lanigera tRNA
  156. Chionis minor (black-faced sheathbill) tRNA
  157. Chlorocebus sabaeus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  158. Chloropsis cyanopogon tRNA
  159. Chloropsis hardwickii tRNA
  160. Choloepus hoffmanni tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  161. Chordeiles acutipennis (lesser nighthawk) tRNA
  162. Vaccinia virus GLV-1h68 chr17.trna16-GlnTTG from Vaccinia virus GLV-1h68 (PDB 8C8H, chain U)
  163. Chrysemys picta bellii tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  164. Chrysochloris asiatica tRNA
  165. Chrysodeixis includens tRNA
  166. Cimex lectularius (Bed bug) tRNA-Gln
  167. Cinara cedri tRNA
  168. Cinclus mexicanus tRNA
  169. Circaetus pectoralis tRNA
  170. Cisticola juncidis tRNA
  171. Clarias magur (asian catfish) tRNA
  172. Cloeon dipterum tRNA
  173. Cnephaeus nilssonii tRNA-Gln
  174. Colinus virginianus (northern bobwhite) tRNA
  175. Collichthys lucidus tRNA
  176. Colobus angolensis palliatus tRNA
  177. Columba livia (Rock pigeon) tRNA
  178. Conger conger tRNA
  179. Copsychus sechellarum tRNA
  180. Coptotermes formosanus (Formosan subterranean termite) tRNA
  181. Cordylochernes scorpioides tRNA-Gln
  182. Corvus brachyrhynchos (American crow) tRNA
  183. Corvus moneduloides (new caledonian crow) tRNA
  184. Corythaixoides concolor (grey go-away-bird) tRNA
  185. Cottoperca gobio tRNA
  186. Gymnorhina tibicen Cracticus tibicen (Australian magpie) tRNA
  187. Magallana angulata Crassostrea angulata (Portuguese oyster) transfer RNA glutamine (anticodon UUG)
  188. Magallana angulata Crassostrea angulata (Portuguese oyster) transfer RNA glutamine (anticodon UUG)
  189. Crassostrea virginica tRNA-Gln
  190. Crenichthys baileyi tRNA-Gln
  191. Cricetulus griseus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  192. Crocodylus porosus (Australian saltwater crocodile) tRNA
  193. Crocuta crocuta (spotted hyena) tRNA
  194. Cryptotermes secundus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1, tRNA-Gln-TTG-2-2)
  195. Crypturellus soui tRNA
  196. Crypturellus undulatus tRNA
  197. Cuculus canorus (common cuckoo) tRNA
  198. Cyanistes caeruleus tRNA
  199. Cyclopterus lumpus tRNA
  200. Cydia pomonella (The codling moth) transfer RNA glutamine (anticodon UUG)
  201. Cynoglossus semilaevis (tongue sole) tRNA
  202. Cyphomyrmex costatus tRNA
  203. Cyprinodon variegatus tRNA
  204. Cyprinus carpio carpio tRNA
  205. Cyprinus carpio (common carp) tRNA
  206. Daktulosphaira vitifoliae (Grape phylloxera) transfer RNA glutamine (anticodon UUG)
  207. Danaus chrysippus (African queen) tRNA
  208. Danaus plexippus (monarch butterfly) misc RNA ENSDPXG00000018329.1
  209. Danaus plexippus plexippus (Monarch butterfly) tRNA-Gln
  210. Danionella cerebrum tRNA-Gln
  211. Danionella translucida tRNA
  212. Danio rerio tRNA-Gln (TTG) (tRNA-Gln-TTG-4 1 to 3)
  213. Dasyornis broadbenti (rufous bristle-bird) tRNA
  214. Dasypus novemcinctus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  215. Daubentonia madagascariensis tRNA-Gln
  216. Delphinapterus leucas (beluga whale) tRNA
  217. Setophaga kirtlandii Dendroica kirtlandii (Kirtland's warbler) tRNA
  218. Denticeps clupeoides (denticle herring) tRNA
  219. Dermacentor andersoni transfer RNA glutamine (anticodon UUG)
  220. Dermacentor silvarum transfer RNA glutamine (anticodon UUG)
  221. Diachasma alloeum tRNA
  222. Diaphorina citri (Asian citrus psyllid) tRNA-Gln
  223. Diatraea saccharalis (sugarcane borer) tRNA
  224. Dicentrarchus labrax tRNA
  225. Dinoponera quadriceps (south american ant) tRNA
  226. Dipodomys ordii tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  227. Dissostichus eleginoides tRNA-Gln
  228. Dissostichus mawsoni tRNA
  229. Diuraphis noxia tRNA-Gln
  230. Dolichomitus sp. PSUC_FEM 10030005 tRNA
  231. Donacobius atricapilla tRNA
  232. Dromaius novaehollandiae (emu) tRNA
  233. Drymodes brunneopygia tRNA
  234. Dryococelus australis tRNA-OTHER
  235. Dryoscopus gambensis tRNA
  236. Dufourea novaeangliae (Bee) tRNA-Gln
  237. Echeneis naucrates (live sharksucker) tRNA
  238. Echinops telfairi tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  239. Edolisoma coerulescens tRNA
  240. Electrophorus electricus (electric eel) tRNA
  241. Elysia chlorotica (eastern emerald elysia) tRNA
  242. Emberiza fucata tRNA
  243. Enhydra lutris kenyoni tRNA
  244. Eolophus roseicapilla Eolophus roseicapillus (Galah) tRNA
  245. Eptatretus burgeri (inshore hagfish) tRNA
  246. Cnephaeus nilssonii Eptesicus nilssoni (northern bat) tRNA
  247. Equus asinus (ass) tRNA
  248. Equus caballus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  249. Erinaceus europaeus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  250. Erpetoichthys calabaricus (reedfish) tRNA
  251. Erpornis zantholeuca tRNA
  252. Erysiphe pulchra tRNA
  253. Erythrocercus mccallii tRNA
  254. Chloebia gouldiae Erythrura gouldiae (Gouldian finch) tRNA
  255. Etheostoma spectabile (orangethroat darter) tRNA
  256. Eubucco bourcierii (red-headed barbet) tRNA
  257. Eudromia elegans (elegant crested-tinamou) tRNA
  258. Eufriesea mexicana (Mexican orchid bee) tRNA-Gln
  259. Eumeta japonica tRNA
  260. Calidris pygmaea Eurynorhynchus pygmeus tRNA
  261. Eurystomus gularis tRNA
  262. Exocentrus adspersus tRNA-OTHER
  263. Falco tinnunculus (common kestrel) tRNA
  264. Felis catus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  265. Ficedula albicollis tRNA
  266. Fopius arisanus tRNA
  267. Frankliniella occidentalis (western flower thrips) tRNA
  268. Fregetta grallaria tRNA
  269. Frieseomelitta varia tRNA
  270. Furnarius figulus tRNA
  271. Gadus morhua 'NCC' tRNA-Gln
  272. Gadus morhua tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1, tRNA-Gln-TTG-1-2)
  273. Galbula dea tRNA
  274. Galemys pyrenaicus tRNA
  275. Galleria mellonella (greater wax moth) tRNA
  276. Pampusana beccarii Gallicolumba beccarii (bronze ground-dove) tRNA
  277. Gallus gallus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  278. Gambusia affinis (western mosquitofish) tRNA
  279. Gammaproteobacteria bacterium tRNA-Gln
  280. Gasterosteus aculeatus tRNA
  281. Gekko kuhli tRNA-Gln
  282. Chelonoidis abingdonii Geochelone nigra abingdoni tRNA
  283. Geococcyx californianus tRNA
  284. Geospiza fortis tRNA
  285. Glareola pratincola tRNA
  286. Glaucidium brasilianum (ferruginous pygmy-owl) tRNA
  287. Goodea atripinnis tRNA-Gln
  288. Gopherus agassizii (desert tortoise) tRNA
  289. Gopherus evgoodei (goodes thornscrub tortoise) tRNA
  290. Gorilla gorilla gorilla tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  291. Grallaria varia (variegated antpitta) tRNA
  292. Grantiella picta tRNA
  293. Gulo gulo (wolverine) tRNA
  294. Gymnodraco acuticeps tRNA
  295. Gymnothorax javanicus tRNA-Gln
  296. Habropoda laboriosa (Southeastern blueberry bee) tRNA-Gln
  297. Halcyon senegalensis tRNA
  298. Haliotis rubra tRNA-Gln
  299. Haliotis rufescens (Red abalone) tRNA-Gln
  300. Halyomorpha halys (Brown marmorated stink bug) tRNA-Gln
  301. Haplochromis burtoni tRNA
  302. Harpegnathos saltator (Indian jumping ant) tRNA-Gln
  303. Heliconius melpomene tRNA HMEL014838
  304. Helicoverpa armigera transfer RNA glutamine (anticodon UUG)
  305. Helicoverpa zea (Corn earworm) tRNA-Gln
  306. Heliothis virescens (tobacco budworm) tRNA
  307. Hemibagrus wyckioides tRNA
  308. Herpetotheres cachinnans tRNA
  309. Heterocephalus glaber tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  310. Heterotrigona itama tRNA
  311. Hippoglossus stenolepis (Pacific halibut) tRNA-Gln
  312. Hipposideros armiger tRNA
  313. Hirundo rustica rustica tRNA
  314. Homalodisca vitripennis tRNA-Gln
  315. Homo sapiens tRNA-Gln (anticodon TTG) 1-1 (TRQ-TTG1-1)
  316. Horornis vulcanius tRNA
  317. Hyalomma asiaticum (Tick) tRNA-Gln for anticodon UUG
  318. Hylaeus anthracinus (Anthricinan yellow-faced bee) transfer RNA glutamine (anticodon UUG)
  319. Hylaeus volcanicus (Volcano Masked Bee) transfer RNA glutamine (anticodon UUG)
  320. Hypocryptadius cinnamomeus tRNA
  321. Ichneumon xanthorius (Ichneumon Wasp) misc RNA ENSIXAG00005010634.1
  322. Ictidomys tridecemlineatus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  323. Ifrita kowaldi (blue-capped ifrita) tRNA
  324. Ignelater luminosus (cucubano) tRNA
  325. Illadopsis cleaveri (blackcap illadopsis) tRNA
  326. Ilyodon furcidens tRNA-Gln
  327. Indicator maculatus tRNA
  328. Inia geoffrensis tRNA-Gln
  329. Irena cyanogastra Irena cyanogaster tRNA
  330. Ischnura elegans (Damselflies) tRNA-Gln
  331. Ixodes persulcatus tRNA-Gln for anticodon UUG
  332. Ixodes scapularis (Black-legged tick) tRNA-Gln
  333. Jacana jacana (wattled jacana) tRNA
  334. Jaculus jaculus (lesser Egyptian jerboa) tRNA
  335. Junco hyemalis (dark-eyed junco) tRNA
  336. Kryptolebias marmoratus (mangrove rivulus) tRNA
  337. Labeo rohita (rohu) tRNA
  338. Labrus bergylta (ballan wrasse) tRNA
  339. Ladona fulva tRNA
  340. Lamprotornis superbus tRNA
  341. Laodelphax striatellus (small brown planthopper) tRNA
  342. Larimichthys crocea tRNA
  343. Larus smithsonianus tRNA
  344. Lasius niger tRNA
  345. Lates calcarifer (barramundi perch) tRNA
  346. Latimeria chalumnae tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1, tRNA-Gln-TTG-1-2)
  347. Leguminivora glycinivorella (Soybean pod borer) tRNA-Gln
  348. Leiothrix lutea (red-billed leiothrix) tRNA
  349. Lepidothrix coronata tRNA
  350. Lepisosteus oculatus tRNA
  351. Leptobrachium leishanense (Leishan spiny toad) tRNA
  352. Leptocoma aspasia tRNA
  353. Leptonychotes weddellii (Weddell seal) tRNA
  354. Leucopsar rothschildi tRNA
  355. Limulus polyphemus tRNA-Gln
  356. Linepithema humile (Argentine ant) transfer RNA glutamine (anticodon UUG)
  357. Lineus longissimus (Bootlace worm) misc RNA ENSLLNG00015025189.1
  358. Lingula anatina (Lamp shell) tRNA-Gln
  359. Liolophura japonica (Chitons) transfer RNA glutamine (anticodon UUG)
  360. Liparis tanakae tRNA
  361. Lipotes vexillifer (Yangtze River dolphin) tRNA
  362. Helopsaltes ochotensis Locustella ochotensis tRNA
  363. Lonchura striata tRNA
  364. Desmophyllum pertusum Lophelia pertusa tRNA
  365. Lophotis ruficrista tRNA
  366. Loxia curvirostra tRNA
  367. Loxodonta africana tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1, tRNA-Gln-TTG-1-2)
  368. Lupinus angustifolius (narrow-leaved blue lupine) tRNA
  369. Lycocorax pyrrhopterus obiensis tRNA-Gln
  370. Lynx canadensis (Canada lynx) tRNA
  371. Lynx pardinus (Spanish lynx) tRNA
  372. Macaca fascicularis (crab-eating macaque) tRNA
  373. Macaca mulatta tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  374. Macaca nemestrina (pig-tailed macaque) tRNA
  375. Macrosteles quadrilineatus (Aster leafhopper) transfer RNA glutamine (anticodon UUG)
  376. Magallana gigas (Pacific oyster) transfer RNA glutamine (anticodon UUG)
  377. Malurus elegans (Red-winged fairywren) tRNA
  378. Mandrillus leucophaeus (drill) tRNA
  379. Manduca sexta tRNA-Gln
  380. Marmota marmota marmota (Alpine marmot) tRNA
  381. Marmota monax tRNA
  382. Mastacembelus armatus tRNA
  383. Mauremys mutica tRNA
  384. Maylandia zebra (zebra mbuna) tRNA
  385. Megachile rotundata tRNA-Gln
  386. Megalops atlanticus (tarpon) tRNA
  387. Melanaphis sacchari (Sugarcane aphid) tRNA-Gln
  388. Meleagris gallopavo tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  389. Melipona bicolor tRNA
  390. Melipona quadrifasciata tRNA
  391. Melitaea cinxia misc RNA ENSMCXG00005023295.1
  392. Melospiza melodia (song sparrow) tRNA
  393. Menidia menidia (Atlantic silverside) tRNA
  394. Menura novaehollandiae (superb lyrebird) tRNA
  395. Merluccius polli (Benguela hake) tRNA
  396. Mesocricetus auratus (golden hamster) tRNA
  397. Microcaecilia unicolor tRNA
  398. Microcebus murinus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  399. Microctonus aethiopoides tRNA
  400. Microctonus hyperodae tRNA
  401. Microplitis demolitor (Parasitoid wasp) transfer RNA glutamine (anticodon UUG)
  402. Microplitis mediator (Endoparasitoid wasp) transfer RNA glutamine (anticodon UUG)
  403. Microtus ochrogaster (prairie vole) tRNA
  404. Mionectes macconnelli (McConnell's flycatcher) tRNA
  405. Mola mola (ocean sunfish) tRNA
  406. Molorchus minor tRNA-OTHER
  407. Molossus molossus (Pallas's mastiff bat) tRNA
  408. Molothrus ater tRNA
  409. Neomonachus schauinslandi Monachus schauinslandi (Hawaiian monk seal) tRNA
  410. Monodelphis domestica tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  411. Monodon monoceros (narwhal) tRNA
  412. Monomorium pharaonis (Pharaoh ant) tRNA-Gln
  413. Moschus moschiferus (Siberian musk deer) tRNA
  414. Muntiacus reevesi (Chinese muntjac) tRNA
  415. Muraenolepis orangiensis (Patagonian moray cod) tRNA
  416. Mus caroli tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  417. Mus musculus castaneus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  418. Mus musculus domesticus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  419. Mus musculus musculus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  420. Mus musculus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  421. Mus pahari tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  422. Mus spicilegus (steppe mouse) tRNA
  423. Mus spretus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  424. Mustela putorius furo tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  425. Myiagra hebetior tRNA
  426. Myotis davidii tRNA
  427. Myotis lucifugus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  428. Myotis myotis tRNA
  429. Myripristis murdjan (pinecone soldierfish) tRNA
  430. Mystacornis crossleyi tRNA
  431. Nannospalax galili (Upper Galilee mountains blind mole rat) tRNA
  432. Nasonia vitripennis (Jewel wasp) tRNA-Gln
  433. Nematostella vectensis tRNA-Gln for anticodon UUG
  434. Neodiprion lecontei tRNA-Gln
  435. Neodiprion pinetum (White pine sawfly) tRNA-Gln
  436. Neodrepanis coruscans (wattled asity) tRNA
  437. Neogobius melanostomus (round goby) tRNA
  438. Neolamprologus brichardi tRNA
  439. Neophocaena asiaeorientalis asiaeorientalis (yangtze finless porpoise) tRNA
  440. Neopipo cinnamomea tRNA
  441. Neotoma lepida (desert woodrat) tRNA
  442. Neogale vison Neovison vison tRNA
  443. Nesospiza acunhae tRNA
  444. Nezara viridula (southern green stink bug) tRNA
  445. Nicator chloris tRNA
  446. Nilaparvata lugens tRNA-Gln
  447. Nomascus leucogenys tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1, tRNA-Gln-TTG-1-2)
  448. Nothobranchius furzeri tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1, tRNA-Gln-TTG-1-2)
  449. Nothoprocta perdicaria tRNA
  450. Notiomystis cincta tRNA
  451. Notodromas monacha tRNA
  452. Notothenia coriiceps (black rockcod) tRNA
  453. Nyctereutes procyonoides (raccoon dog) tRNA
  454. Nyctibius grandis tRNA
  455. Nycticryphes semicollaris tRNA
  456. Nyctiprogne leucopyga tRNA
  457. Nylanderia fulva tRNA
  458. Oceanites oceanicus tRNA
  459. Ochotona princeps tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1, tRNA-Gln-TTG-2-2)
  460. Octodon degus (degu) tRNA
  461. Odobenus rosmarus divergens (Pacific walrus) tRNA
  462. Odocoileus virginianus texanus tRNA
  463. Onthophagus taurus tRNA-Gln
  464. Onychorhynchus coronatus tRNA
  465. Onychostoma macrolepis tRNA
  466. Ooceraea biroi tRNA-Gln
  467. Operophtera brumata tRNA
  468. Orbicella faveolata (Mountainous star coral) tRNA-Gln
  469. Oreocharis arfaki tRNA
  470. Oreochromis aureus tRNA
  471. Oreochromis niloticus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1, tRNA-Gln-TTG-2-2)
  472. Oreotrochilus melanogaster tRNA
  473. Oriolus oriolus tRNA
  474. Ornithodoros turicata (Softbacked ticks) transfer RNA glutamine (anticodon UUG)
  475. Ornithorhynchus anatinus (platypus) tRNA
  476. Orthonyx spaldingii (northern chowchilla) tRNA
  477. Orussus abietinus tRNA-Gln
  478. Orycteropus afer afer tRNA
  479. Oryctes borbonicus tRNA
  480. Oryctolagus cuniculus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1, tRNA-Gln-TTG-2-2)
  481. Oryzias javanicus tRNA
  482. Oryzias latipes tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  483. Oryzias melastigma (Indian medaka) tRNA
  484. Oryzias sinensis tRNA
  485. Ostrea edulis (Mud oyster) transfer RNA glutamine (anticodon UUG)
  486. Otolemur garnettii tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  487. Otus sunia (Oriental scops-owl) tRNA
  488. Ovis aries tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  489. Oxyruncus cristatus (sharpbill) tRNA
  490. Pachycephala philippinensis tRNA
  491. Pachyramphus minor tRNA
  492. Pangasianodon gigas tRNA-Gln
  493. Pangasianodon hypophthalmus tRNA
  494. Pangasius djambal tRNA-Gln
  495. Pan paniscus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  496. Panthera leo (lion) tRNA
  497. Panthera tigris altaica (Amur tiger) tRNA
  498. Pan troglodytes tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  499. Panurus biarmicus tRNA
  500. Papilio machaon tRNA
  501. Papilio xuthus tRNA
  502. Papio anubis tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  503. Sinosuthora webbiana Paradoxornis webbianus tRNA
  504. Pararge aegeria aegeria tRNA
  505. Pararge aegeria tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  506. Arctia plantaginis Parasemia plantaginis tRNA
  507. Parnassius apollo (apollo) tRNA
  508. Patagioenas fasciata monilis tRNA
  509. Pavo cristatus (Indian peafowl) tRNA
  510. Pectinophora gossypiella transfer RNA glutamine (anticodon UUG)
  511. Pediculus humanus corporis tRNA tRNA-Gln
  512. Pelodiscus sinensis tRNA
  513. Pelusios castaneus tRNA
  514. Penelope pileata tRNA
  515. Perca flavescens (yellow perch) tRNA
  516. Perca fluviatilis (European perch) tRNA
  517. Peromyscus maniculatus bairdii (prairie deer mouse) tRNA
  518. Peromyscus maniculatus sonoriensis tRNA-Gln
  519. Peucedramus taeniatus (olive warbler) tRNA
  520. Phainopepla nitens tRNA
  521. Phascolarctos cinereus (koala) tRNA
  522. Pheucticus melanocephalus tRNA
  523. Phocoena sinus (vaquita) tRNA
  524. Photinus pyralis (Common eastern firefly) tRNA-Gln
  525. Phrynocephalus forsythii tRNA
  526. Phthorimaea operculella tRNA-Gln
  527. Phyllostomus discolor (pale spear-nosed bat) tRNA
  528. Physeter macrocephalus Physeter catodon (sperm whale) tRNA
  529. Piaya cayana (squirrel cuckoo) tRNA
  530. Picathartes gymnocephalus tRNA
  531. Dryobates pubescens Picoides pubescens (downy woodpecker) tRNA
  532. Piliocolobus tephrosceles (Ugandan red Colobus) tRNA
  533. Pipistrellus kuhlii (Kuhl's pipistrelle) tRNA
  534. Pipra filicauda tRNA
  535. Pitta sordida (hooded pitta) tRNA
  536. Platysteira castanea tRNA
  537. Platysternon megacephalum (big-headed turtle) tRNA
  538. Plecturocebus cupreus tRNA-OTHER
  539. Pleuronectes platessa tRNA
  540. Ploceus nigricollis tRNA
  541. Plodia interpunctella (Indianmeal moth) transfer RNA glutamine (anticodon UUG)
  542. Plutella xylostella tRNA
  543. Pluvianellus socialis (magellanic plover) tRNA
  544. Pocillopora damicornis (Cauliflower coral) tRNA-Gln
  545. Podarcis lilfordi tRNA
  546. Podarcis muralis tRNA
  547. Podargus strigoides (tawny frogmouth) tRNA
  548. Podilymbus podiceps tRNA
  549. Poecile atricapillus Poecile atricapilla (Black-capped chickadee) tRNA
  550. Poecilia formosa tRNA
  551. Poecilia reticulata (guppy) tRNA
  552. Pogona vitticeps (central bearded dragon) tRNA
  553. Pogonomyrmex barbatus tRNA-Gln
  554. Pogonomyrmex californicus tRNA-Gln
  555. Polioptila caerulea tRNA
  556. Polistes canadensis (Red paper wasp) tRNA-Gln
  557. Polistes dominula (European paper wasp) tRNA-Gln
  558. Polistes fuscatus (Common paper wasp) tRNA-Gln
  559. Polyplax serrata tRNA-Gln
  560. Polypterus senegalus tRNA
  561. Pomacea canaliculata (Apple snail) tRNA-Gln
  562. Pomatorhinus ruficollis tRNA
  563. Pomatostomus ruficeps (chestnut-crowned babbler) tRNA
  564. Pongo abelii tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  565. Potamilus streckersoni tRNA-Gln
  566. Probosciger aterrimus tRNA
  567. Procavia capensis tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  568. Prolemur simus (greater bamboo lemur) tRNA
  569. Promerops cafer (Cape sugarbird) tRNA
  570. Propithecus coquereli (Coquerel's sifaka) tRNA
  571. Prunella fulvescens tRNA
  572. Prunella himalayana tRNA
  573. Parambassis ranga Pseudambassis ranga (Indian glassy fish) tRNA
  574. Pseudoatta argentina tRNA
  575. Pseudonaja textilis tRNA
  576. Psilopogon haemacephalus tRNA
  577. Psophia crepitans (common trumpeter) tRNA
  578. Pterocles burchelli tRNA
  579. Pteropus alecto (black flying fox) tRNA
  580. Pteropus vampyrus (large flying fox) tRNA
  581. Pteruthius melanotis tRNA
  582. Puma concolor (puma) tRNA
  583. Pundamilia nyererei tRNA
  584. Brachypodius melanocephalos Pycnonotus atriceps tRNA
  585. Pycnonotus jocosus tRNA
  586. Python bivittatus Python molurus bivittatus (Burmese python) tRNA
  587. Quiscalus mexicanus tRNA
  588. Ramphastos sulfuratus tRNA
  589. Rattus norvegicus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  590. Rhabdornis inornatus tRNA
  591. Rhamnusium bicolor tRNA-Gln
  592. Rhinolophus ferrumequinum (greater horseshoe bat) tRNA
  593. Rhinopithecus bieti (Black snub-nosed monkey) tRNA
  594. Rhinopithecus roxellana (golden snub-nosed monkey) tRNA
  595. Rhinopomastus cyanomelas (common scimitar-bill) tRNA
  596. Rhipicephalus microplus tRNA-Gln
  597. Rhipicephalus sanguineus transfer RNA glutamine (anticodon UUG)
  598. Rhodinocichla rosea tRNA
  599. Rhodnius prolixus (Kissing bug) tRNA tRNA-Gln
  600. Rhopalosiphum maidis tRNA-Gln
  601. Rhopilema esculentum tRNA-Gln (TTG) (tRNA-Gln-TTG-1 1 to 3)
  602. Rousettus aegyptiacus (Egyptian rousette) tRNA
  603. Saccoglossus kowalevskii (Acorn worm) tRNA-Gln
  604. Sagittarius serpentarius tRNA
  605. Saimiri boliviensis boliviensis tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  606. Sakesphorus luctuosus tRNA
  607. Salarias fasciatus (jewelled blenny) tRNA
  608. Sander lucioperca (pike-perch) tRNA
  609. Sapayoa aenigma (broad-billed sapayoa) tRNA
  610. Sarcophilus harrisii (Tasmanian devil) tRNA
  611. Schistocerca americana tRNA-Gln
  612. Schistocerca cancellata (South American locust) transfer RNA glutamine (anticodon UUG)
  613. Schistocerca gregaria (Grasshoppers) transfer RNA glutamine (anticodon UUG)
  614. Schistocerca nitens (Vagrant locust) transfer RNA glutamine (anticodon UUG)
  615. Schistocerca piceifrons (Central American locust) tRNA-Gln
  616. Schistocerca serialis cubense (Grasshoppers) transfer RNA glutamine (anticodon UUG)
  617. Sciurus carolinensis (gray squirrel) tRNA
  618. Sciurus vulgaris (Eurasian red squirrel) tRNA
  619. Scleropages formosus tRNA
  620. Sclerurus mexicanus (tawny-throated leaftosser) tRNA
  621. Scophthalmus maximus (turbot) tRNA
  622. Scopus umbretta (hamerkop) tRNA
  623. Scyliorhinus torazame (cloudy catshark) tRNA
  624. Scytalopus superciliaris tRNA
  625. Semnornis frantzii tRNA
  626. Acanthosepion pharaonis Sepia pharaonis tRNA
  627. Serilophus lunatus (silver-breasted broadbill) tRNA
  628. Silurus meridionalis tRNA
  629. Sinocyclocheilus anshuiensis tRNA
  630. Sinocyclocheilus grahami tRNA
  631. Sinocyclocheilus rhinocerous tRNA
  632. Sipha flava (Yellow sugarcane aphid) tRNA-Gln
  633. Sitta europaea (wood nuthatch) tRNA
  634. Solenopsis invicta tRNA-Gln
  635. Sousa chinensis (Indo-pacific humpbacked dolphin) tRNA
  636. Sparus aurata (gilthead seabream) tRNA
  637. Spermophilus dauricus (Daurian ground squirrel) tRNA
  638. Urocitellus parryii Spermophilus parryii (Arctic ground squirrel) tRNA
  639. Sphaeramia orbicularis tRNA
  640. Sphaerodactylus townsendi tRNA-Gln
  641. Sphenodon punctatus (tuatara) tRNA
  642. Spizaetus tyrannus (black hawk-eagle) tRNA
  643. Spizella passerina (chipping sparrow) tRNA
  644. Spodoptera exigua (beet armyworm) tRNA
  645. Spodoptera frugiperda tRNA-Gln (TTG) (tRNA-Gln-TTG-1 1 to 3)
  646. Spodoptera littoralis tRNA
  647. Spodoptera litura tRNA
  648. Steatornis caripensis (oilbird) tRNA
  649. Stegastes partitus (bicolor damselfish) tRNA
  650. Stegodyphus dumicola tRNA-Gln
  651. Stercorarius parasiticus tRNA
  652. Strigamia maritima tRNA
  653. Strigops habroptila (kakapo) tRNA
  654. Strix occidentalis caurina tRNA
  655. Stylophora pistillata tRNA-Gln
  656. Sula dactylatra tRNA
  657. Suricata suricatta (meerkat) tRNA
  658. Sus scrofa tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  659. Sylvia borin tRNA
  660. Symphalangus syndactylus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  661. Synaphobranchus kaupii (Kaup's arrowtooth eel) tRNA
  662. Syrrhaptes paradoxus (Pallas's sandgrouse) tRNA
  663. Taeniopygia guttata tRNA
  664. Takifugu bimaculatus tRNA
  665. Takifugu flavidus tRNA
  666. Takifugu rubripes tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1, tRNA-Gln-TTG-1-2)
  667. Temnothorax curvispinosus tRNA
  668. Temnothorax longispinosus tRNA
  669. Tenebrio molitor (yellow mealworm) tRNA
  670. Terrapene triunguis Terrapene carolina triunguis (three-toed box turtle) tRNA
  671. Tetraodon nigroviridis tRNA
  672. Theropithecus gelada (gelada baboon) tRNA
  673. Thinocorus orbignyianus tRNA
  674. Thrips palmi tRNA-Gln
  675. Tinamus guttatus tRNA
  676. Todus mexicanus (puerto rican tody) tRNA
  677. Toxostoma redivivum tRNA
  678. Trachymyrmex cornetzi tRNA
  679. Trachymyrmex septentrionalis tRNA
  680. Mycetomoellerius zeteki Trachymyrmex zeteki tRNA
  681. Trialeurodes vaporariorum (Greenhouse whitefly) tRNA-Gln for anticodon UUG
  682. Tribolium castaneum (Red flour beetle) transfer RNA glutamine (anticodon UUG)
  683. Tribolium madens (Black flour beetle) tRNA-Gln
  684. Trichechus manatus latirostris tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  685. Trichogramma brassicae tRNA
  686. Trichogramma pretiosum tRNA-Gln
  687. Tricholaema leucomelas (pied barbet) tRNA
  688. Trichomalopsis sarcophagae tRNA
  689. Trichoplusia ni (cabbage looper) tRNA
  690. Triplophysa rosa (cave loach) tRNA
  691. Triplophysa tibetana tRNA
  692. Tupaia belangeri chinensis Tupaia chinensis (Chinese tree shrew) tRNA
  693. Salvator merianae Tupinambis merianae tRNA
  694. Turnix velox (little buttonquail) tRNA
  695. Tursiops truncatus (bottlenosed dolphin) tRNA
  696. Tyrannus savana (fork-tailed flycatcher) tRNA
  697. Uloborus diversus (Orb Weaver) transfer RNA glutamine (anticodon UUG)
  698. Upupa epops (Eurasian hoopoe) tRNA
  699. Urocolius indicus tRNA
  700. Urocynchramus pylzowi tRNA
  701. Orthopoxvirus vaccinia URQ-UUG1-1 tRNA (72-MER) from Vaccinia virus (PDB 9FPY, chain U)
  702. Ursus americanus (American black bear) tRNA
  703. Ursus maritimus (polar bear) tRNA
  704. Vanessa tameamea tRNA
  705. Varanus komodoensis tRNA
  706. Venturia canescens tRNA-Gln
  707. Vespa mandarinia (Asian giant hornet) tRNA-Gln
  708. Vespula germanica tRNA
  709. Vespula pensylvanica (western yellowjacket) tRNA
  710. Vespula vulgaris tRNA
  711. Vicugna pacos tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  712. Vidua chalybeata tRNA
  713. Vidua macroura tRNA
  714. Vombatus ursinus (common wombat) tRNA
  715. Vulpes vulpes (red fox) tRNA
  716. Xenoophorus captivus tRNA-Gln
  717. Xenotaenia resolanae tRNA-Gln
  718. Xiphophorus maculatus (southern platyfish) tRNA
  719. Xiphorhynchus elegans (elegant woodcreeper) tRNA
  720. Zapornia atra tRNA
  721. Zootermopsis nevadensis tRNA-Gln (TTG) (tRNA-Gln-TTG-1 1 to 3)
  722. Zophobas morio tRNA
  723. Zosterops borbonicus tRNA
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...

 Publications