Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Platysteira castanea tRNA secondary structure diagram

Platysteira castanea tRNA URS000035EE7E_1160851

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUCCCAUGGUGUAAUGGUUAGCACUCUGGACUUUGAAUCCAGCGAUCCGAGUUCAAAUCUCGGUGGGACCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 697 other species

  1. Acanthochromis polyacanthus tRNA
  2. Accipiter nisus (Eurasian sparrowhawk) tRNA
  3. Acinonyx jubatus (cheetah) tRNA
  4. Acipenser ruthenus (sterlet) tRNA
  5. Acrocephalus arundinaceus (great reed warbler) tRNA
  6. Acromyrmex charruanus tRNA
  7. Acromyrmex echinatior (Panamanian leaf-cutter ant) tRNA-Gln
  8. Acromyrmex heyeri tRNA
  9. Acropora cervicornis tRNA-Gln
  10. Acropora millepora (Stony coral) tRNA-Gln
  11. Adelges cooleyi (Spruce gall adelgid) transfer RNA glutamine (anticodon UUG)
  12. Aegithalos caudatus tRNA
  13. Aegotheles bennettii tRNA
  14. Agrilus planipennis (Emerald ash borer) tRNA-Gln
  15. Ailuropoda melanoleuca tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  16. Albula glossodonta (roundjaw bonefish) tRNA
  17. Albula goreensis tRNA
  18. Alligator mississippiensis tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  19. Alligator sinensis (Chinese alligator) tRNA
  20. Amazona aestiva tRNA
  21. Amazona collaria (yellow-billed parrot) tRNA
  22. Amazona guildingii tRNA
  23. Amblyteles armatorius (Ichneumon Wasp) misc RNA ENSAAYG00000011492.1
  24. Ameca splendens tRNA-Gln
  25. Ameiurus melas tRNA
  26. Amphiprion ocellaris (clown anemonefish) tRNA
  27. Amphiprion percula tRNA
  28. Amyelois transitella (Naval orange worm) tRNA-Gln
  29. Anabarilius grahami tRNA
  30. Anabas testudineus tRNA
  31. Anas platyrhynchos platyrhynchos (common mallard) tRNA
  32. Anas zonorhyncha tRNA
  33. Ancistrocerus nigricornis (Potter wasp) misc RNA ENSANRG00000003640.1
  34. Anguilla anguilla tRNA
  35. Anolis carolinensis tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  36. Anseranas semipalmata (magpie goose) tRNA
  37. Anser brachyrhynchus (pink-footed goose) tRNA
  38. Anser cygnoides (Chinese goose) tRNA
  39. Anthoscopus minutus tRNA
  40. Aotus nancymaae (Ma's night monkey) tRNA
  41. Aphelocoma coerulescens (scrub jay) tRNA
  42. Apis cerana cerana tRNA
  43. Apis dorsata tRNA-Gln
  44. Apis florea tRNA-Gln
  45. Apis mellifera tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1, tRNA-Gln-TTG-2-2)
  46. Aplysia californica tRNA-Gln (TTG) (tRNA-Gln-TTG-1 1 to 10)
  47. Apteryx mantelli mantelli Apteryx australis mantelli tRNA
  48. Apteryx owenii (little spotted kiwi) tRNA
  49. Aquila chrysaetos chrysaetos tRNA
  50. Arctogadus glacialis (Arctic cod) tRNA-Gln
  51. Ardeotis kori tRNA
  52. Arenaria interpres (ruddy turnstone) tRNA
  53. Aromia moschata tRNA-Gln
  54. Asarcornis scutulata tRNA
  55. Asbolus verrucosus (desert ironclad beetle) tRNA
  56. Astyanax mexicanus (Mexican tetra) tRNA
  57. Ataeniobius toweri tRNA-Gln
  58. Athalia rosae misc RNA ENSAEAG00005004799.1
  59. Atlantisia rogersi (inaccessible island rail) tRNA
  60. Atractosteus spatula (alligator gar) tRNA
  61. Atrichornis clamosus tRNA
  62. Atta cephalotes (Leaf-cutter ant) tRNA LOC105616953-2
  63. Atta colombica tRNA
  64. Austrofundulus limnaeus tRNA
  65. Aythya fuligula (tufted duck) tRNA
  66. Bagarius yarrelli (goonch) tRNA
  67. Balaeniceps rex (shoebill) tRNA
  68. Balaenoptera acutorostrata scammoni tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  69. Balaenoptera musculus (Blue whale) tRNA
  70. Bambusicola thoracicus Bambusicola thoracica (Chinese bamboo-partridge) tRNA
  71. Baryphthengus martii tRNA
  72. Betta splendens (Siamese fighting fish) tRNA
  73. Bicyclus anynana (Squinting bush brown) tRNA-Gln
  74. Biomphalaria glabrata tRNA tRNA-Gln
  75. Biomphalaria pfeifferi tRNA-Gln
  76. Bison bison bison (north american plains bison) tRNA
  77. Blattella germanica tRNA-Gln (TTG) (tRNA-Gln-TTG-1 1 to 11)
  78. Bombus affinis (Rusty patched bumble bee) transfer RNA glutamine (anticodon UUG)
  79. Bombus huntii (Hunt's bumblebee) transfer RNA glutamine (anticodon UUG)
  80. Bombus terrestris tRNA LOC110119478
  81. Bombus vancouverensis nearcticus (Montane Bumble Bee) tRNA-Gln
  82. Bombus vosnesenskii tRNA
  83. Bombycilla garrulus tRNA
  84. Bombyx mandarina (Wild silkworm) tRNA-Gln
  85. Bombyx mori tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  86. Boreogadus saida tRNA-Gln
  87. Bos grunniens (domestic yak) tRNA
  88. Bos mutus Bos grunniens mutus tRNA
  89. Bos indicus tRNA
  90. Bos indicus x Bos taurus (hybrid cattle) tRNA
  91. Bos taurus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  92. Brachypteracias leptosomus (short-legged ground-roller) tRNA
  93. Branchiostoma belcheri (Belcher's lancelet) tRNA
  94. Branchiostoma floridae tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  95. Branchiostoma lanceolatum (amphioxus) tRNA
  96. Brenthis ino (lesser marbled fritillary) tRNA
  97. Bucco capensis (collared puffbird) tRNA
  98. Bucorvus abyssinicus tRNA
  99. Buphagus erythrorhynchus (red-billed oxpecker) tRNA
  100. Burhinus bistriatus tRNA
  101. Cairina moschata domestica (muscovy duck (domestic type)) tRNA
  102. Alaudala cheleensis Calandrella cheleensis tRNA
  103. Calcarius ornatus tRNA
  104. Callaeas wilsoni (north island kokako) tRNA
  105. Callipepla squamata tRNA
  106. Callithrix jacchus tRNA-Gln (TTG) (tRNA-Gln-TTG-4-1)
  107. Callorhinchus milii tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  108. Callorhinus ursinus (northern fur seal) tRNA
  109. Caloenas nicobarica tRNA
  110. Calypte anna (Anna's hummingbird) tRNA
  111. Camarhynchus parvulus tRNA
  112. Camelus bactrianus (Bactrian camel) tRNA
  113. Camelus dromedarius (Arabian camel) tRNA
  114. Camelus ferus (Wild Bactrian camel) tRNA
  115. Camponotus floridanus (Florida carpenter ant) tRNA-Gln
  116. Campylorhamphus procurvoides tRNA
  117. Candidula unifasciata tRNA
  118. Canis lupus dingo (dingo) tRNA
  119. Canis lupus familiaris tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  120. Capra hircus (goat) tRNA
  121. Carassius auratus (goldfish) tRNA
  122. Cardinalis cardinalis tRNA
  123. Carlito syrichta tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  124. Castor canadensis (American beaver) tRNA
  125. Cataglyphis hispanica (Desert ant) transfer RNA glutamine (anticodon UUG)
  126. Catagonus wagneri (Chacoan peccary) tRNA
  127. Catharus fuscescens tRNA
  128. Catharus ustulatus tRNA
  129. Cavia porcellus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1, tRNA-Gln-TTG-1-2)
  130. Sapajus apella Cebus apella (Tufted capuchin) tRNA
  131. Cebus imitator (Panamanian white-faced capuchin) tRNA
  132. Centropus unirufus tRNA
  133. Centruroides sculpturatus (Bark scorpion) tRNA-Gln
  134. Cephus cinctus (wheat stem sawfly) tRNA
  135. Cepphus grylle tRNA
  136. Ceratotherium simum simum tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  137. Cercocebus atys (sooty mangabey) tRNA
  138. Cercotrichas coryphoeus (Karoo scrub-robin) tRNA
  139. Cervus elaphus hippelaphus tRNA
  140. Cervus hanglu yarkandensis Cervus elaphus yarkandensis tRNA
  141. Cettia cetti tRNA
  142. Ceuthmochares aereus tRNA
  143. Chaetorhynchus papuensis (pygmy drongo) tRNA
  144. Channa argus (snakehead) tRNA
  145. Chanos chanos (milkfish) tRNA
  146. Characodon lateralis tRNA-Gln
  147. Chauna torquata (southern screamer) tRNA
  148. Chelonia mydas (green seaturtle) tRNA
  149. Chelonus insularis tRNA-Gln
  150. Chelydra serpentina (snapping turtle) tRNA
  151. Chiloscyllium punctatum (brownbanded bambooshark) tRNA
  152. Chinchilla lanigera tRNA
  153. Chionis minor (black-faced sheathbill) tRNA
  154. Chlorocebus sabaeus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  155. Chloropsis cyanopogon tRNA
  156. Chloropsis hardwickii tRNA
  157. Choloepus hoffmanni tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  158. Chordeiles acutipennis (lesser nighthawk) tRNA
  159. Vaccinia virus GLV-1h68 chr17.trna16-GlnTTG from Vaccinia virus GLV-1h68 (PDB 8C8H, chain U)
  160. Chrysemys picta bellii tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  161. Chrysochloris asiatica tRNA
  162. Chrysodeixis includens tRNA
  163. Cimex lectularius tRNA-Gln
  164. Cinara cedri tRNA
  165. Cinclus mexicanus tRNA
  166. Circaetus pectoralis tRNA
  167. Cisticola juncidis tRNA
  168. Clarias magur (asian catfish) tRNA
  169. Cloeon dipterum tRNA
  170. Colinus virginianus (northern bobwhite) tRNA
  171. Collichthys lucidus tRNA
  172. Colobus angolensis palliatus tRNA
  173. Columba livia (Rock pigeon) tRNA
  174. Conger conger tRNA
  175. Copsychus sechellarum tRNA
  176. Coptotermes formosanus (Formosan subterranean termite) tRNA
  177. Cordylochernes scorpioides tRNA-Gln
  178. Corvus brachyrhynchos (American crow) tRNA
  179. Corvus moneduloides (new caledonian crow) tRNA
  180. Corythaixoides concolor (grey go-away-bird) tRNA
  181. Cottoperca gobio tRNA
  182. Gymnorhina tibicen Cracticus tibicen (Australian magpie) tRNA
  183. Magallana angulata Crassostrea angulata (Portuguese oyster) transfer RNA glutamine (anticodon UUG)
  184. Magallana gigas (Pacific oyster) tRNA-Gln for anticodon UUG
  185. Crassostrea virginica tRNA-Gln
  186. Crenichthys baileyi tRNA-Gln
  187. Cricetulus griseus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  188. Crocodylus porosus (Australian saltwater crocodile) tRNA
  189. Crocuta crocuta (spotted hyena) tRNA
  190. Cryptotermes secundus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1, tRNA-Gln-TTG-2-2)
  191. Crypturellus soui tRNA
  192. Crypturellus undulatus tRNA
  193. Cuculus canorus (common cuckoo) tRNA
  194. Cyanistes caeruleus tRNA
  195. Cyclopterus lumpus tRNA
  196. Cynoglossus semilaevis (tongue sole) tRNA
  197. Cyphomyrmex costatus tRNA
  198. Cyprinodon variegatus tRNA
  199. Cyprinus carpio carpio tRNA
  200. Cyprinus carpio (common carp) tRNA
  201. Daktulosphaira vitifoliae (Grape phylloxera) transfer RNA glutamine (anticodon UUG)
  202. Danaus chrysippus (African queen) tRNA
  203. Danaus plexippus plexippus tRNA
  204. Danionella cerebrum tRNA-Gln
  205. Danionella translucida tRNA
  206. Danio rerio tRNA-Gln (TTG) (tRNA-Gln-TTG-4 1 to 3)
  207. Dasyornis broadbenti (rufous bristle-bird) tRNA
  208. Dasypus novemcinctus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  209. Daubentonia madagascariensis tRNA-Gln
  210. Delphinapterus leucas (beluga whale) tRNA
  211. Setophaga kirtlandii Dendroica kirtlandii (Kirtland's warbler) tRNA
  212. Denticeps clupeoides (denticle herring) tRNA
  213. Dermacentor andersoni transfer RNA glutamine (anticodon UUG)
  214. Dermacentor silvarum (Tick) transfer RNA glutamine (anticodon UUG)
  215. Diachasma alloeum tRNA
  216. Diaphorina citri (Asian citrus psyllid) tRNA-Gln
  217. Diatraea saccharalis (sugarcane borer) tRNA
  218. Dicentrarchus labrax (European seabass) tRNA
  219. Dinoponera quadriceps (south american ant) tRNA
  220. Dipodomys ordii tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  221. Dissostichus mawsoni tRNA
  222. Diuraphis noxia (Russian wheat aphid) tRNA-Gln
  223. Dolichomitus sp. PSUC_FEM 10030005 tRNA
  224. Donacobius atricapilla tRNA
  225. Dromaius novaehollandiae (emu) tRNA
  226. Drymodes brunneopygia tRNA
  227. Dryococelus australis tRNA-OTHER
  228. Dryoscopus gambensis tRNA
  229. Dufourea novaeangliae (Bee) tRNA-Gln
  230. Echeneis naucrates (live sharksucker) tRNA
  231. Echinops telfairi tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  232. Edolisoma coerulescens tRNA
  233. Electrophorus electricus (electric eel) tRNA
  234. Elysia chlorotica (eastern emerald elysia) tRNA
  235. Emberiza fucata tRNA
  236. Enhydra lutris kenyoni tRNA
  237. Eolophus roseicapilla Eolophus roseicapillus (Galah) tRNA
  238. Eptatretus burgeri (inshore hagfish) tRNA
  239. Cnephaeus nilssonii Eptesicus nilssoni (northern bat) tRNA
  240. Equus asinus (ass) tRNA
  241. Equus caballus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  242. Erinaceus europaeus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  243. Erpetoichthys calabaricus (reedfish) tRNA
  244. Erpornis zantholeuca tRNA
  245. Erysiphe pulchra tRNA
  246. Erythrocercus mccallii tRNA
  247. Chloebia gouldiae Erythrura gouldiae (Gouldian finch) tRNA
  248. Etheostoma spectabile (orangethroat darter) tRNA
  249. Eubucco bourcierii (red-headed barbet) tRNA
  250. Eudromia elegans (elegant crested-tinamou) tRNA
  251. Eufriesea mexicana tRNA-Gln
  252. Eumeta japonica tRNA
  253. Calidris pygmaea Eurynorhynchus pygmeus tRNA
  254. Eurystomus gularis tRNA
  255. Exocentrus adspersus tRNA-OTHER
  256. Falco tinnunculus (common kestrel) tRNA
  257. Felis catus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  258. Ficedula albicollis tRNA
  259. Fopius arisanus tRNA
  260. Frankliniella occidentalis (western flower thrips) tRNA
  261. Fregetta grallaria tRNA
  262. Frieseomelitta varia tRNA
  263. Furnarius figulus tRNA
  264. Gadus morhua 'NCC' tRNA-Gln
  265. Gadus morhua tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1, tRNA-Gln-TTG-1-2)
  266. Galbula dea tRNA
  267. Galemys pyrenaicus tRNA
  268. Galleria mellonella tRNA-Gln
  269. Pampusana beccarii Gallicolumba beccarii (bronze ground-dove) tRNA
  270. Gallus gallus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  271. Gambusia affinis (western mosquitofish) tRNA
  272. Gasterosteus aculeatus (three-spined stickleback) tRNA
  273. Chelonoidis abingdonii Geochelone nigra abingdoni tRNA
  274. Geococcyx californianus tRNA
  275. Geospiza fortis tRNA
  276. Glareola pratincola tRNA
  277. Glaucidium brasilianum (ferruginous pygmy-owl) tRNA
  278. Goodea atripinnis tRNA-Gln
  279. Gopherus agassizii (desert tortoise) tRNA
  280. Gopherus evgoodei (goodes thornscrub tortoise) tRNA
  281. Gorilla gorilla gorilla tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  282. Grallaria varia (variegated antpitta) tRNA
  283. Grantiella picta tRNA
  284. Gulo gulo (wolverine) tRNA
  285. Gymnodraco acuticeps tRNA
  286. Habropoda laboriosa tRNA-Gln
  287. Halcyon senegalensis tRNA
  288. Haliotis rubra tRNA-Gln
  289. Haliotis rufescens tRNA-Gln
  290. Halyomorpha halys (Brown marmorated stink bug) tRNA-Gln
  291. Haplochromis burtoni tRNA
  292. Harpegnathos saltator tRNA-Gln
  293. Heliconius melpomene (Postman butterfly) tRNA HMEL014838
  294. Helicoverpa armigera (Cotton bollworm) transfer RNA glutamine (anticodon UUG)
  295. Helicoverpa zea (Corn earworm) tRNA-Gln
  296. Heliothis virescens (tobacco budworm) tRNA
  297. Hemibagrus wyckioides tRNA
  298. Herpetotheres cachinnans tRNA
  299. Heterocephalus glaber tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  300. Heterotrigona itama tRNA
  301. Hippoglossus stenolepis (Pacific halibut) tRNA-Gln
  302. Hipposideros armiger tRNA
  303. Hirundo rustica rustica tRNA
  304. Homalodisca vitripennis (Glassy winged sharpshooter) tRNA-Gln
  305. Homo sapiens tRNA-Gln (anticodon TTG) 1-1 (TRQ-TTG1-1)
  306. Horornis vulcanius tRNA
  307. Hyalomma asiaticum (Tick) tRNA-Gln for anticodon UUG
  308. Hylaeus anthracinus (Anthricinan yellow-faced bee) transfer RNA glutamine (anticodon UUG)
  309. Hylaeus volcanicus (Volcano Masked Bee) transfer RNA glutamine (anticodon UUG)
  310. Hypocryptadius cinnamomeus tRNA
  311. Ichneumon xanthorius (Ichneumon Wasp) misc RNA ENSIXAG00005010634.1
  312. Ictidomys tridecemlineatus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  313. Ifrita kowaldi (blue-capped ifrita) tRNA
  314. Ignelater luminosus (cucubano) tRNA
  315. Illadopsis cleaveri (blackcap illadopsis) tRNA
  316. Ilyodon furcidens tRNA-Gln
  317. Indicator maculatus tRNA
  318. Irena cyanogastra Irena cyanogaster tRNA
  319. Ixodes persulcatus (Taiga tick) tRNA-Gln for anticodon UUG
  320. Ixodes scapularis tRNA-Gln
  321. Jacana jacana (wattled jacana) tRNA
  322. Jaculus jaculus (lesser Egyptian jerboa) tRNA
  323. Junco hyemalis (dark-eyed junco) tRNA
  324. Kryptolebias marmoratus (mangrove rivulus) tRNA
  325. Labeo rohita (rohu) tRNA
  326. Labrus bergylta (ballan wrasse) tRNA
  327. Ladona fulva tRNA
  328. Lamprotornis superbus tRNA
  329. Laodelphax striatellus (small brown planthopper) tRNA
  330. Larimichthys crocea tRNA
  331. Larus smithsonianus tRNA
  332. Lasius niger tRNA
  333. Lates calcarifer (barramundi perch) tRNA
  334. Latimeria chalumnae tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1, tRNA-Gln-TTG-1-2)
  335. Leguminivora glycinivorella tRNA-Gln
  336. Leiothrix lutea (red-billed leiothrix) tRNA
  337. Lepidothrix coronata tRNA
  338. Lepisosteus oculatus (spotted gar) tRNA
  339. Leptobrachium leishanense (Leishan spiny toad) tRNA
  340. Leptocoma aspasia tRNA
  341. Leptonychotes weddellii (Weddell seal) tRNA
  342. Leucopsar rothschildi tRNA
  343. Limulus polyphemus tRNA-Gln
  344. Linepithema humile tRNA-Gln
  345. Lineus longissimus (Bootlace worm) misc RNA ENSLLNG00015025189.1
  346. Lingula anatina tRNA-Gln
  347. Liparis tanakae tRNA
  348. Lipotes vexillifer (Yangtze River dolphin) tRNA
  349. Helopsaltes ochotensis Locustella ochotensis tRNA
  350. Lonchura striata tRNA
  351. Desmophyllum pertusum Lophelia pertusa tRNA
  352. Lophotis ruficrista tRNA
  353. Loxia curvirostra tRNA
  354. Loxodonta africana tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1, tRNA-Gln-TTG-1-2)
  355. Lupinus angustifolius (narrow-leaved blue lupine) tRNA
  356. Lynx canadensis (Canada lynx) tRNA
  357. Lynx pardinus (Spanish lynx) tRNA
  358. Macaca fascicularis (crab-eating macaque) tRNA
  359. Macaca mulatta tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  360. Macaca nemestrina (pig-tailed macaque) tRNA
  361. Macrosteles quadrilineatus (Aster leafhopper) transfer RNA glutamine (anticodon UUG)
  362. Malurus elegans (Red-winged fairywren) tRNA
  363. Mandrillus leucophaeus (drill) tRNA
  364. Manduca sexta tRNA-Gln
  365. Marmota marmota marmota (Alpine marmot) tRNA
  366. Marmota monax (woodchuck) tRNA
  367. Mastacembelus armatus tRNA
  368. Mauremys mutica tRNA
  369. Maylandia zebra (zebra mbuna) tRNA
  370. Megachile rotundata tRNA-Gln
  371. Megalops atlanticus tRNA
  372. Melanaphis sacchari (Sugarcane aphid) tRNA-Gln
  373. Meleagris gallopavo tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  374. Melipona bicolor tRNA
  375. Melipona quadrifasciata tRNA
  376. Melitaea cinxia (Glanville fritillary) misc RNA ENSMCXG00005023295.1
  377. Melospiza melodia (song sparrow) tRNA
  378. Menidia menidia (Atlantic silverside) tRNA
  379. Menura novaehollandiae (superb lyrebird) tRNA
  380. Merluccius polli (Benguela hake) tRNA
  381. Mesocricetus auratus (golden hamster) tRNA
  382. Microcaecilia unicolor tRNA
  383. Microcebus murinus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  384. Microctonus aethiopoides tRNA
  385. Microctonus hyperodae tRNA
  386. Microplitis demolitor (Parasitoid wasp) transfer RNA glutamine (anticodon UUG)
  387. Microplitis mediator (Endoparasitoid wasp) transfer RNA glutamine (anticodon UUG)
  388. Microtus ochrogaster (prairie vole) tRNA
  389. Mionectes macconnelli (McConnell's flycatcher) tRNA
  390. Mola mola (ocean sunfish) tRNA
  391. Molorchus minor tRNA-OTHER
  392. Molossus molossus (Pallas's mastiff bat) tRNA
  393. Molothrus ater tRNA
  394. Neomonachus schauinslandi Monachus schauinslandi (Hawaiian monk seal) tRNA
  395. Monodelphis domestica tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  396. Monodon monoceros (narwhal) tRNA
  397. Monomorium pharaonis (Pharaoh ant) tRNA-Gln
  398. Moschus moschiferus (Siberian musk deer) tRNA
  399. Muntiacus reevesi (Chinese muntjac) tRNA
  400. Muraenolepis orangiensis (Patagonian moray cod) tRNA
  401. Mus caroli tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  402. Mus musculus castaneus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  403. Mus musculus domesticus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  404. Mus musculus musculus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  405. Mus musculus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  406. Mus pahari tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  407. Mus spicilegus (steppe mouse) tRNA
  408. Mus spretus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  409. Mustela putorius furo tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  410. Myiagra hebetior tRNA
  411. Myotis davidii tRNA
  412. Myotis lucifugus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  413. Myotis myotis tRNA
  414. Myripristis murdjan (pinecone soldierfish) tRNA
  415. Mystacornis crossleyi tRNA
  416. Nannospalax galili (Upper Galilee mountains blind mole rat) tRNA
  417. Nasonia vitripennis tRNA-Gln
  418. Nematostella vectensis (Starlet sea anemone) tRNA-Gln for anticodon UUG
  419. Neodiprion lecontei tRNA-Gln
  420. Neodiprion pinetum tRNA-Gln
  421. Neodrepanis coruscans (wattled asity) tRNA
  422. Neogobius melanostomus (round goby) tRNA
  423. Neolamprologus brichardi tRNA
  424. Neophocaena asiaeorientalis asiaeorientalis (yangtze finless porpoise) tRNA
  425. Neopipo cinnamomea tRNA
  426. Neotoma lepida tRNA
  427. Neogale vison Neovison vison tRNA
  428. Nesospiza acunhae tRNA
  429. Nezara viridula (southern green stink bug) tRNA
  430. Nicator chloris tRNA
  431. Nilaparvata lugens (Brown planthopper) tRNA-Gln
  432. Nomascus leucogenys tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1, tRNA-Gln-TTG-1-2)
  433. Nothobranchius furzeri tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1, tRNA-Gln-TTG-1-2)
  434. Nothoprocta perdicaria tRNA
  435. Notiomystis cincta tRNA
  436. Notodromas monacha tRNA
  437. Notothenia coriiceps (black rockcod) tRNA
  438. Nyctereutes procyonoides (raccoon dog) tRNA
  439. Nyctibius grandis tRNA
  440. Nycticryphes semicollaris tRNA
  441. Nyctiprogne leucopyga tRNA
  442. Nylanderia fulva tRNA
  443. Oceanites oceanicus tRNA
  444. Ochotona princeps tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1, tRNA-Gln-TTG-2-2)
  445. Octodon degus (degu) tRNA
  446. Odobenus rosmarus divergens (Pacific walrus) tRNA
  447. Odocoileus virginianus texanus tRNA
  448. Onthophagus taurus (Dung beetle) tRNA-Gln
  449. Onychorhynchus coronatus tRNA
  450. Onychostoma macrolepis tRNA
  451. Ooceraea biroi tRNA-Gln
  452. Operophtera brumata (winter moth) tRNA
  453. Orbicella faveolata tRNA-Gln
  454. Oreocharis arfaki tRNA
  455. Oreochromis aureus tRNA
  456. Oreochromis niloticus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1, tRNA-Gln-TTG-2-2)
  457. Oreotrochilus melanogaster tRNA
  458. Oriolus oriolus tRNA
  459. Ornithorhynchus anatinus (platypus) tRNA
  460. Orthonyx spaldingii (northern chowchilla) tRNA
  461. Orussus abietinus tRNA-Gln
  462. Orycteropus afer afer tRNA
  463. Oryctes borbonicus tRNA
  464. Oryctolagus cuniculus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1, tRNA-Gln-TTG-2-2)
  465. Oryzias javanicus tRNA
  466. Oryzias latipes tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  467. Oryzias melastigma (Indian medaka) tRNA
  468. Oryzias sinensis tRNA
  469. Ostrea edulis (European flat oyster) transfer RNA glutamine (anticodon UUG)
  470. Otolemur garnettii tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  471. Otus sunia (Oriental scops-owl) tRNA
  472. Ovis aries tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  473. Oxyruncus cristatus (sharpbill) tRNA
  474. Pachycephala philippinensis tRNA
  475. Pachyramphus minor tRNA
  476. Pangasianodon gigas tRNA-Gln
  477. Pangasianodon hypophthalmus tRNA
  478. Pangasius djambal tRNA-Gln
  479. Pan paniscus (pygmy chimpanzee) tRNA
  480. Panthera leo (lion) tRNA
  481. Panthera tigris altaica (Amur tiger) tRNA
  482. Pan troglodytes tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  483. Panurus biarmicus tRNA
  484. Papilio machaon tRNA
  485. Papilio xuthus tRNA
  486. Papio anubis tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  487. Sinosuthora webbiana Paradoxornis webbianus tRNA
  488. Pararge aegeria aegeria tRNA
  489. Pararge aegeria tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  490. Arctia plantaginis Parasemia plantaginis tRNA
  491. Parnassius apollo (apollo) tRNA
  492. Patagioenas fasciata monilis tRNA
  493. Pavo cristatus (Indian peafowl) tRNA
  494. Pectinophora gossypiella (Pink bollworm) transfer RNA glutamine (anticodon UUG)
  495. Pediculus humanus corporis tRNA tRNA-Gln
  496. Pelodiscus sinensis (Chinese softshell turtle) tRNA
  497. Pelusios castaneus tRNA
  498. Penelope pileata tRNA
  499. Perca flavescens tRNA
  500. Perca fluviatilis (European perch) tRNA
  501. Peromyscus maniculatus bairdii (prairie deer mouse) tRNA
  502. Peucedramus taeniatus (olive warbler) tRNA
  503. Phainopepla nitens tRNA
  504. Phascolarctos cinereus (koala) tRNA
  505. Pheucticus melanocephalus tRNA
  506. Phocoena sinus (vaquita) tRNA
  507. Photinus pyralis (common eastern firefly) tRNA
  508. Phrynocephalus forsythii tRNA
  509. Phyllostomus discolor (pale spear-nosed bat) tRNA
  510. Physeter macrocephalus Physeter catodon (sperm whale) tRNA
  511. Piaya cayana (squirrel cuckoo) tRNA
  512. Picathartes gymnocephalus tRNA
  513. Dryobates pubescens Picoides pubescens (downy woodpecker) tRNA
  514. Piliocolobus tephrosceles (Ugandan red Colobus) tRNA
  515. Pipistrellus kuhlii (Kuhl's pipistrelle) tRNA
  516. Pipra filicauda tRNA
  517. Pitta sordida (hooded pitta) tRNA
  518. Platysternon megacephalum (big-headed turtle) tRNA
  519. Plecturocebus cupreus tRNA-OTHER
  520. Pleuronectes platessa (European plaice) tRNA
  521. Ploceus nigricollis tRNA
  522. Plodia interpunctella (Indianmeal moth) transfer RNA glutamine (anticodon UUG)
  523. Plutella xylostella (diamondback moth) tRNA
  524. Pluvianellus socialis (magellanic plover) tRNA
  525. Pocillopora damicornis tRNA-Gln
  526. Podarcis lilfordi tRNA
  527. Podarcis muralis tRNA
  528. Podargus strigoides (tawny frogmouth) tRNA
  529. Podilymbus podiceps tRNA
  530. Poecile atricapillus Poecile atricapilla (Black-capped chickadee) tRNA
  531. Poecilia formosa tRNA
  532. Poecilia reticulata (guppy) tRNA
  533. Pogona vitticeps (central bearded dragon) tRNA
  534. Pogonomyrmex barbatus tRNA-Gln
  535. Polioptila caerulea tRNA
  536. Polistes canadensis (Red paper wasp) tRNA-Gln
  537. Polistes dominula tRNA-Gln
  538. Polistes fuscatus (Common paper wasp) tRNA-Gln
  539. Polyplax serrata tRNA-Gln
  540. Polypterus senegalus tRNA
  541. Pomacea canaliculata tRNA-Gln
  542. Pomatorhinus ruficollis tRNA
  543. Pomatostomus ruficeps (chestnut-crowned babbler) tRNA
  544. Pongo abelii tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  545. Potamilus streckersoni tRNA-Gln
  546. Probosciger aterrimus tRNA
  547. Procavia capensis tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  548. Prolemur simus (greater bamboo lemur) tRNA
  549. Promerops cafer (Cape sugarbird) tRNA
  550. Propithecus coquereli (Coquerel's sifaka) tRNA
  551. Prunella fulvescens tRNA
  552. Prunella himalayana tRNA
  553. Parambassis ranga Pseudambassis ranga (Indian glassy fish) tRNA
  554. Pseudoatta argentina tRNA
  555. Pseudonaja textilis tRNA
  556. Psilopogon haemacephalus tRNA
  557. Psophia crepitans (common trumpeter) tRNA
  558. Pterocles burchelli tRNA
  559. Pteropus alecto (black flying fox) tRNA
  560. Pteropus vampyrus (large flying fox) tRNA
  561. Pteruthius melanotis tRNA
  562. Puma concolor (puma) tRNA
  563. Pundamilia nyererei tRNA
  564. Brachypodius melanocephalos Pycnonotus atriceps tRNA
  565. Pycnonotus jocosus tRNA
  566. Python bivittatus Python molurus bivittatus (Burmese python) tRNA
  567. Quiscalus mexicanus tRNA
  568. Ramphastos sulfuratus tRNA
  569. Rattus norvegicus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  570. Rhabdornis inornatus tRNA
  571. Rhamnusium bicolor tRNA-Gln
  572. Rhinolophus ferrumequinum (greater horseshoe bat) tRNA
  573. Rhinopithecus bieti (Black snub-nosed monkey) tRNA
  574. Rhinopithecus roxellana (golden snub-nosed monkey) tRNA
  575. Rhinopomastus cyanomelas (common scimitar-bill) tRNA
  576. Rhipicephalus microplus (Southern cattle tick) tRNA-Gln
  577. Rhipicephalus sanguineus (Brown dog tick) transfer RNA glutamine (anticodon UUG)
  578. Rhodinocichla rosea tRNA
  579. Rhodnius prolixus (Kissing bug) tRNA tRNA-Gln
  580. Rhopalosiphum maidis tRNA-Gln
  581. Rousettus aegyptiacus (Egyptian rousette) tRNA
  582. Saccoglossus kowalevskii (Acorn worm) tRNA-Gln
  583. Sagittarius serpentarius tRNA
  584. Saimiri boliviensis boliviensis tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  585. Sakesphorus luctuosus tRNA
  586. Salarias fasciatus (jewelled blenny) tRNA
  587. Sander lucioperca (pike-perch) tRNA
  588. Sapayoa aenigma (broad-billed sapayoa) tRNA
  589. Sarcophilus harrisii (Tasmanian devil) tRNA
  590. Schistocerca americana tRNA-Gln
  591. Schistocerca cancellata (South American locust) transfer RNA glutamine (anticodon UUG)
  592. Schistocerca gregaria (Grasshoppers) transfer RNA glutamine (anticodon UUG)
  593. Schistocerca nitens (Vagrant locust) transfer RNA glutamine (anticodon UUG)
  594. Schistocerca piceifrons (Central American locust) tRNA-Gln
  595. Schistocerca serialis cubense (Grasshoppers) transfer RNA glutamine (anticodon UUG)
  596. Sciurus carolinensis (gray squirrel) tRNA
  597. Sciurus vulgaris (Eurasian red squirrel) tRNA
  598. Scleropages formosus tRNA
  599. Sclerurus mexicanus (tawny-throated leaftosser) tRNA
  600. Scophthalmus maximus (turbot) tRNA
  601. Scopus umbretta (hamerkop) tRNA
  602. Scyliorhinus torazame (cloudy catshark) tRNA
  603. Scytalopus superciliaris tRNA
  604. Semnornis frantzii tRNA
  605. Acanthosepion pharaonis Sepia pharaonis tRNA
  606. Serilophus lunatus (silver-breasted broadbill) tRNA
  607. Silurus meridionalis tRNA
  608. Sinocyclocheilus anshuiensis tRNA
  609. Sinocyclocheilus grahami tRNA
  610. Sinocyclocheilus rhinocerous tRNA
  611. Sipha flava tRNA-Gln
  612. Sitta europaea (wood nuthatch) tRNA
  613. Solenopsis invicta (red fire ant) tRNA
  614. Sousa chinensis (Indo-pacific humpbacked dolphin) tRNA
  615. Sparus aurata (gilthead seabream) tRNA
  616. Spermophilus dauricus (Daurian ground squirrel) tRNA
  617. Urocitellus parryii Spermophilus parryii (Arctic ground squirrel) tRNA
  618. Sphaeramia orbicularis tRNA
  619. Sphaerodactylus townsendi tRNA-Gln
  620. Sphenodon punctatus (tuatara) tRNA
  621. Spizaetus tyrannus (black hawk-eagle) tRNA
  622. Spizella passerina (chipping sparrow) tRNA
  623. Spodoptera exigua (beet armyworm) tRNA
  624. Spodoptera frugiperda tRNA-Gln (TTG) (tRNA-Gln-TTG-1 1 to 3)
  625. Spodoptera littoralis tRNA
  626. Spodoptera litura tRNA
  627. Steatornis caripensis (oilbird) tRNA
  628. Stegastes partitus (bicolor damselfish) tRNA
  629. Stegodyphus dumicola tRNA-Gln
  630. Stercorarius parasiticus tRNA
  631. Strigamia maritima tRNA
  632. Strigops habroptila (kakapo) tRNA
  633. Strix occidentalis caurina tRNA
  634. Stylophora pistillata (Hood coral) tRNA-Gln
  635. Sula dactylatra tRNA
  636. Suricata suricatta (meerkat) tRNA
  637. Sus scrofa tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  638. Sylvia borin tRNA
  639. Synaphobranchus kaupii (Kaup's arrowtooth eel) tRNA
  640. Syrrhaptes paradoxus (Pallas's sandgrouse) tRNA
  641. Taeniopygia guttata tRNA
  642. Takifugu bimaculatus tRNA
  643. Takifugu flavidus tRNA
  644. Takifugu rubripes tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1, tRNA-Gln-TTG-1-2)
  645. Temnothorax curvispinosus tRNA
  646. Temnothorax longispinosus tRNA
  647. Tenebrio molitor (yellow mealworm) tRNA
  648. Terrapene triunguis Terrapene carolina triunguis (three-toed box turtle) tRNA
  649. Tetraodon nigroviridis tRNA
  650. Theropithecus gelada (gelada baboon) tRNA
  651. Thinocorus orbignyianus tRNA
  652. Thrips palmi tRNA-Gln
  653. Tinamus guttatus tRNA
  654. Todus mexicanus (puerto rican tody) tRNA
  655. Toxostoma redivivum tRNA
  656. Trachymyrmex cornetzi tRNA
  657. Trachymyrmex septentrionalis tRNA
  658. Mycetomoellerius zeteki Trachymyrmex zeteki tRNA
  659. Trialeurodes vaporariorum (Greenhouse whitefly) tRNA-Gln for anticodon UUG
  660. Tribolium castaneum tRNA-Gln for anticodon UUG
  661. Tribolium madens (Black flour beetle) tRNA-Gln
  662. Trichechus manatus latirostris tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  663. Trichogramma brassicae tRNA
  664. Trichogramma pretiosum (Parasitoid wasp) tRNA-Gln
  665. Tricholaema leucomelas (pied barbet) tRNA
  666. Trichomalopsis sarcophagae tRNA
  667. Trichoplusia ni (cabbage looper) tRNA
  668. Triplophysa rosa (cave loach) tRNA
  669. Triplophysa tibetana tRNA
  670. Tupaia chinensis (Chinese tree shrew) tRNA
  671. Salvator merianae Tupinambis merianae tRNA
  672. Turnix velox (little buttonquail) tRNA
  673. Tursiops truncatus (bottlenosed dolphin) tRNA
  674. Tyrannus savana (fork-tailed flycatcher) tRNA
  675. Uloborus diversus (Orb Weaver) transfer RNA glutamine (anticodon UUG)
  676. Upupa epops (Eurasian hoopoe) tRNA
  677. Urocolius indicus tRNA
  678. Urocynchramus pylzowi tRNA
  679. Orthopoxvirus vaccinia URQ-UUG1-1 tRNA (72-MER) from Vaccinia virus (PDB 9FPY, chain U)
  680. Ursus americanus (American black bear) tRNA
  681. Ursus maritimus (polar bear) tRNA
  682. Vanessa tameamea tRNA
  683. Varanus komodoensis tRNA
  684. Venturia canescens tRNA-Gln
  685. Vespula germanica tRNA
  686. Vespula pensylvanica (western yellowjacket) tRNA
  687. Vespula vulgaris tRNA
  688. Vicugna pacos tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  689. Vidua chalybeata tRNA
  690. Vidua macroura tRNA
  691. Vombatus ursinus (common wombat) tRNA
  692. Vulpes vulpes (red fox) tRNA
  693. Xenoophorus captivus tRNA-Gln
  694. Xenotaenia resolanae tRNA-Gln
  695. Xiphophorus maculatus (southern platyfish) tRNA
  696. Xiphorhynchus elegans (elegant woodcreeper) tRNA
  697. Zapornia atra tRNA
  698. Zootermopsis nevadensis tRNA-Gln (TTG) (tRNA-Gln-TTG-1 1 to 3)
  699. Zophobas morio tRNA
  700. Zosterops borbonicus tRNA
Relationships

Molecular Relationships

2D structure

Loading 2D structure...