Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Acromyrmex heyeri tRNA secondary structure diagram

Acromyrmex heyeri tRNA URS000035EE7E_230685

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUCCCAUGGUGUAAUGGUUAGCACUCUGGACUUUGAAUCCAGCGAUCCGAGUUCAAAUCUCGGUGGGACCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 697 other species

  1. Acanthochromis polyacanthus tRNA
  2. Accipiter nisus (Eurasian sparrowhawk) tRNA
  3. Acinonyx jubatus (cheetah) tRNA
  4. Acipenser ruthenus (sterlet) tRNA
  5. Acrocephalus arundinaceus (great reed warbler) tRNA
  6. Acromyrmex charruanus tRNA
  7. Acromyrmex echinatior (Panamanian leaf-cutter ant) tRNA-Gln
  8. Acropora cervicornis tRNA-Gln
  9. Acropora millepora (Stony coral) tRNA-Gln
  10. Adelges cooleyi (Spruce gall adelgid) transfer RNA glutamine (anticodon UUG)
  11. Aegithalos caudatus tRNA
  12. Aegotheles bennettii tRNA
  13. Agrilus planipennis (Emerald ash borer) tRNA-Gln
  14. Ailuropoda melanoleuca tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  15. Albula glossodonta (roundjaw bonefish) tRNA
  16. Albula goreensis tRNA
  17. Alligator mississippiensis tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  18. Alligator sinensis (Chinese alligator) tRNA
  19. Amazona aestiva tRNA
  20. Amazona collaria (yellow-billed parrot) tRNA
  21. Amazona guildingii tRNA
  22. Amblyteles armatorius (Ichneumon Wasp) misc RNA ENSAAYG00000011492.1
  23. Ameca splendens tRNA-Gln
  24. Ameiurus melas tRNA
  25. Amphiprion ocellaris (clown anemonefish) tRNA
  26. Amphiprion percula tRNA
  27. Amyelois transitella (Naval orange worm) tRNA-Gln
  28. Anabarilius grahami tRNA
  29. Anabas testudineus tRNA
  30. Anas platyrhynchos platyrhynchos (common mallard) tRNA
  31. Anas zonorhyncha tRNA
  32. Ancistrocerus nigricornis (Potter wasp) misc RNA ENSANRG00000003640.1
  33. Anguilla anguilla tRNA
  34. Anolis carolinensis tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  35. Anseranas semipalmata (magpie goose) tRNA
  36. Anser brachyrhynchus (pink-footed goose) tRNA
  37. Anser cygnoides (Chinese goose) tRNA
  38. Anthoscopus minutus tRNA
  39. Aotus nancymaae (Ma's night monkey) tRNA
  40. Aphelocoma coerulescens (scrub jay) tRNA
  41. Apis cerana cerana tRNA
  42. Apis dorsata tRNA-Gln
  43. Apis florea tRNA-Gln
  44. Apis mellifera tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1, tRNA-Gln-TTG-2-2)
  45. Aplysia californica tRNA-Gln (TTG) (tRNA-Gln-TTG-1 1 to 10)
  46. Apteryx mantelli mantelli Apteryx australis mantelli tRNA
  47. Apteryx owenii (little spotted kiwi) tRNA
  48. Aquila chrysaetos chrysaetos tRNA
  49. Arctogadus glacialis (Arctic cod) tRNA-Gln
  50. Ardeotis kori tRNA
  51. Arenaria interpres (ruddy turnstone) tRNA
  52. Aromia moschata tRNA-Gln
  53. Asarcornis scutulata tRNA
  54. Asbolus verrucosus (desert ironclad beetle) tRNA
  55. Astyanax mexicanus (Mexican tetra) tRNA
  56. Ataeniobius toweri tRNA-Gln
  57. Athalia rosae misc RNA ENSAEAG00005004799.1
  58. Atlantisia rogersi (inaccessible island rail) tRNA
  59. Atractosteus spatula (alligator gar) tRNA
  60. Atrichornis clamosus tRNA
  61. Atta cephalotes (Leaf-cutter ant) tRNA LOC105616953-2
  62. Atta colombica tRNA
  63. Austrofundulus limnaeus tRNA
  64. Aythya fuligula (tufted duck) tRNA
  65. Bagarius yarrelli (goonch) tRNA
  66. Balaeniceps rex (shoebill) tRNA
  67. Balaenoptera acutorostrata scammoni tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  68. Balaenoptera musculus (Blue whale) tRNA
  69. Bambusicola thoracicus Bambusicola thoracica (Chinese bamboo-partridge) tRNA
  70. Baryphthengus martii tRNA
  71. Betta splendens (Siamese fighting fish) tRNA
  72. Bicyclus anynana (Squinting bush brown) tRNA-Gln
  73. Biomphalaria glabrata tRNA tRNA-Gln
  74. Biomphalaria pfeifferi tRNA-Gln
  75. Bison bison bison (north american plains bison) tRNA
  76. Blattella germanica tRNA-Gln (TTG) (tRNA-Gln-TTG-1 1 to 11)
  77. Bombus affinis (Rusty patched bumble bee) transfer RNA glutamine (anticodon UUG)
  78. Bombus huntii (Hunt's bumblebee) transfer RNA glutamine (anticodon UUG)
  79. Bombus terrestris tRNA LOC110119478
  80. Bombus vancouverensis nearcticus (Montane Bumble Bee) tRNA-Gln
  81. Bombus vosnesenskii tRNA
  82. Bombycilla garrulus tRNA
  83. Bombyx mandarina (Wild silkworm) tRNA-Gln
  84. Bombyx mori tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  85. Boreogadus saida tRNA-Gln
  86. Bos grunniens (domestic yak) tRNA
  87. Bos mutus Bos grunniens mutus tRNA
  88. Bos indicus tRNA
  89. Bos indicus x Bos taurus (hybrid cattle) tRNA
  90. Bos taurus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  91. Brachypteracias leptosomus (short-legged ground-roller) tRNA
  92. Branchiostoma belcheri (Belcher's lancelet) tRNA
  93. Branchiostoma floridae tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  94. Branchiostoma lanceolatum (amphioxus) tRNA
  95. Brenthis ino (lesser marbled fritillary) tRNA
  96. Bucco capensis (collared puffbird) tRNA
  97. Bucorvus abyssinicus tRNA
  98. Buphagus erythrorhynchus (red-billed oxpecker) tRNA
  99. Burhinus bistriatus tRNA
  100. Cairina moschata domestica (muscovy duck (domestic type)) tRNA
  101. Alaudala cheleensis Calandrella cheleensis tRNA
  102. Calcarius ornatus tRNA
  103. Callaeas wilsoni (north island kokako) tRNA
  104. Callipepla squamata tRNA
  105. Callithrix jacchus tRNA-Gln (TTG) (tRNA-Gln-TTG-4-1)
  106. Callorhinchus milii tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  107. Callorhinus ursinus (northern fur seal) tRNA
  108. Caloenas nicobarica tRNA
  109. Calypte anna (Anna's hummingbird) tRNA
  110. Camarhynchus parvulus tRNA
  111. Camelus bactrianus (Bactrian camel) tRNA
  112. Camelus dromedarius (Arabian camel) tRNA
  113. Camelus ferus (Wild Bactrian camel) tRNA
  114. Camponotus floridanus (Florida carpenter ant) tRNA-Gln
  115. Campylorhamphus procurvoides tRNA
  116. Candidula unifasciata tRNA
  117. Canis lupus dingo (dingo) tRNA
  118. Canis lupus familiaris tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  119. Capra hircus (goat) tRNA
  120. Carassius auratus (goldfish) tRNA
  121. Cardinalis cardinalis tRNA
  122. Carlito syrichta tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  123. Castor canadensis (American beaver) tRNA
  124. Cataglyphis hispanica (Desert ant) transfer RNA glutamine (anticodon UUG)
  125. Catagonus wagneri (Chacoan peccary) tRNA
  126. Catharus fuscescens tRNA
  127. Catharus ustulatus tRNA
  128. Cavia porcellus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1, tRNA-Gln-TTG-1-2)
  129. Sapajus apella Cebus apella (Tufted capuchin) tRNA
  130. Cebus imitator (Panamanian white-faced capuchin) tRNA
  131. Centropus unirufus tRNA
  132. Centruroides sculpturatus (Bark scorpion) tRNA-Gln
  133. Cephus cinctus (wheat stem sawfly) tRNA
  134. Cepphus grylle tRNA
  135. Ceratotherium simum simum tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  136. Cercocebus atys (sooty mangabey) tRNA
  137. Cercotrichas coryphoeus (Karoo scrub-robin) tRNA
  138. Cervus elaphus hippelaphus tRNA
  139. Cervus hanglu yarkandensis Cervus elaphus yarkandensis tRNA
  140. Cettia cetti tRNA
  141. Ceuthmochares aereus tRNA
  142. Chaetorhynchus papuensis (pygmy drongo) tRNA
  143. Channa argus (snakehead) tRNA
  144. Chanos chanos (milkfish) tRNA
  145. Characodon lateralis tRNA-Gln
  146. Chauna torquata (southern screamer) tRNA
  147. Chelonia mydas (green seaturtle) tRNA
  148. Chelonus insularis tRNA-Gln
  149. Chelydra serpentina (snapping turtle) tRNA
  150. Chiloscyllium punctatum (brownbanded bambooshark) tRNA
  151. Chinchilla lanigera tRNA
  152. Chionis minor (black-faced sheathbill) tRNA
  153. Chlorocebus sabaeus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  154. Chloropsis cyanopogon tRNA
  155. Chloropsis hardwickii tRNA
  156. Choloepus hoffmanni tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  157. Chordeiles acutipennis (lesser nighthawk) tRNA
  158. Vaccinia virus GLV-1h68 chr17.trna16-GlnTTG from Vaccinia virus GLV-1h68 (PDB 8C8H, chain U)
  159. Chrysemys picta bellii tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  160. Chrysochloris asiatica tRNA
  161. Chrysodeixis includens tRNA
  162. Cimex lectularius tRNA-Gln
  163. Cinara cedri tRNA
  164. Cinclus mexicanus tRNA
  165. Circaetus pectoralis tRNA
  166. Cisticola juncidis tRNA
  167. Clarias magur (asian catfish) tRNA
  168. Cloeon dipterum tRNA
  169. Colinus virginianus (northern bobwhite) tRNA
  170. Collichthys lucidus tRNA
  171. Colobus angolensis palliatus tRNA
  172. Columba livia (Rock pigeon) tRNA
  173. Conger conger tRNA
  174. Copsychus sechellarum tRNA
  175. Coptotermes formosanus (Formosan subterranean termite) tRNA
  176. Cordylochernes scorpioides tRNA-Gln
  177. Corvus brachyrhynchos (American crow) tRNA
  178. Corvus moneduloides (new caledonian crow) tRNA
  179. Corythaixoides concolor (grey go-away-bird) tRNA
  180. Cottoperca gobio tRNA
  181. Gymnorhina tibicen Cracticus tibicen (Australian magpie) tRNA
  182. Magallana angulata Crassostrea angulata (Portuguese oyster) transfer RNA glutamine (anticodon UUG)
  183. Magallana gigas (Pacific oyster) tRNA-Gln for anticodon UUG
  184. Crassostrea virginica tRNA-Gln
  185. Crenichthys baileyi tRNA-Gln
  186. Cricetulus griseus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  187. Crocodylus porosus (Australian saltwater crocodile) tRNA
  188. Crocuta crocuta (spotted hyena) tRNA
  189. Cryptotermes secundus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1, tRNA-Gln-TTG-2-2)
  190. Crypturellus soui tRNA
  191. Crypturellus undulatus tRNA
  192. Cuculus canorus (common cuckoo) tRNA
  193. Cyanistes caeruleus tRNA
  194. Cyclopterus lumpus tRNA
  195. Cynoglossus semilaevis (tongue sole) tRNA
  196. Cyphomyrmex costatus tRNA
  197. Cyprinodon variegatus tRNA
  198. Cyprinus carpio carpio tRNA
  199. Cyprinus carpio (common carp) tRNA
  200. Daktulosphaira vitifoliae (Grape phylloxera) transfer RNA glutamine (anticodon UUG)
  201. Danaus chrysippus (African queen) tRNA
  202. Danaus plexippus plexippus tRNA
  203. Danionella cerebrum tRNA-Gln
  204. Danionella translucida tRNA
  205. Danio rerio tRNA-Gln (TTG) (tRNA-Gln-TTG-4 1 to 3)
  206. Dasyornis broadbenti (rufous bristle-bird) tRNA
  207. Dasypus novemcinctus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  208. Daubentonia madagascariensis tRNA-Gln
  209. Delphinapterus leucas (beluga whale) tRNA
  210. Setophaga kirtlandii Dendroica kirtlandii (Kirtland's warbler) tRNA
  211. Denticeps clupeoides (denticle herring) tRNA
  212. Dermacentor andersoni transfer RNA glutamine (anticodon UUG)
  213. Dermacentor silvarum (Tick) transfer RNA glutamine (anticodon UUG)
  214. Diachasma alloeum tRNA
  215. Diaphorina citri (Asian citrus psyllid) tRNA-Gln
  216. Diatraea saccharalis (sugarcane borer) tRNA
  217. Dicentrarchus labrax (European seabass) tRNA
  218. Dinoponera quadriceps (south american ant) tRNA
  219. Dipodomys ordii tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  220. Dissostichus mawsoni tRNA
  221. Diuraphis noxia (Russian wheat aphid) tRNA-Gln
  222. Dolichomitus sp. PSUC_FEM 10030005 tRNA
  223. Donacobius atricapilla tRNA
  224. Dromaius novaehollandiae (emu) tRNA
  225. Drymodes brunneopygia tRNA
  226. Dryococelus australis tRNA-OTHER
  227. Dryoscopus gambensis tRNA
  228. Dufourea novaeangliae (Bee) tRNA-Gln
  229. Echeneis naucrates (live sharksucker) tRNA
  230. Echinops telfairi tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  231. Edolisoma coerulescens tRNA
  232. Electrophorus electricus (electric eel) tRNA
  233. Elysia chlorotica (eastern emerald elysia) tRNA
  234. Emberiza fucata tRNA
  235. Enhydra lutris kenyoni tRNA
  236. Eolophus roseicapilla Eolophus roseicapillus (Galah) tRNA
  237. Eptatretus burgeri (inshore hagfish) tRNA
  238. Cnephaeus nilssonii Eptesicus nilssoni (northern bat) tRNA
  239. Equus asinus (ass) tRNA
  240. Equus caballus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  241. Erinaceus europaeus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  242. Erpetoichthys calabaricus (reedfish) tRNA
  243. Erpornis zantholeuca tRNA
  244. Erysiphe pulchra tRNA
  245. Erythrocercus mccallii tRNA
  246. Chloebia gouldiae Erythrura gouldiae (Gouldian finch) tRNA
  247. Etheostoma spectabile (orangethroat darter) tRNA
  248. Eubucco bourcierii (red-headed barbet) tRNA
  249. Eudromia elegans (elegant crested-tinamou) tRNA
  250. Eufriesea mexicana tRNA-Gln
  251. Eumeta japonica tRNA
  252. Calidris pygmaea Eurynorhynchus pygmeus tRNA
  253. Eurystomus gularis tRNA
  254. Exocentrus adspersus tRNA-OTHER
  255. Falco tinnunculus (common kestrel) tRNA
  256. Felis catus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  257. Ficedula albicollis tRNA
  258. Fopius arisanus tRNA
  259. Frankliniella occidentalis (western flower thrips) tRNA
  260. Fregetta grallaria tRNA
  261. Frieseomelitta varia tRNA
  262. Furnarius figulus tRNA
  263. Gadus morhua 'NCC' tRNA-Gln
  264. Gadus morhua tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1, tRNA-Gln-TTG-1-2)
  265. Galbula dea tRNA
  266. Galemys pyrenaicus tRNA
  267. Galleria mellonella tRNA-Gln
  268. Pampusana beccarii Gallicolumba beccarii (bronze ground-dove) tRNA
  269. Gallus gallus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  270. Gambusia affinis (western mosquitofish) tRNA
  271. Gasterosteus aculeatus (three-spined stickleback) tRNA
  272. Chelonoidis abingdonii Geochelone nigra abingdoni tRNA
  273. Geococcyx californianus tRNA
  274. Geospiza fortis tRNA
  275. Glareola pratincola tRNA
  276. Glaucidium brasilianum (ferruginous pygmy-owl) tRNA
  277. Goodea atripinnis tRNA-Gln
  278. Gopherus agassizii (desert tortoise) tRNA
  279. Gopherus evgoodei (goodes thornscrub tortoise) tRNA
  280. Gorilla gorilla gorilla tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  281. Grallaria varia (variegated antpitta) tRNA
  282. Grantiella picta tRNA
  283. Gulo gulo (wolverine) tRNA
  284. Gymnodraco acuticeps tRNA
  285. Habropoda laboriosa tRNA-Gln
  286. Halcyon senegalensis tRNA
  287. Haliotis rubra tRNA-Gln
  288. Haliotis rufescens tRNA-Gln
  289. Halyomorpha halys (Brown marmorated stink bug) tRNA-Gln
  290. Haplochromis burtoni tRNA
  291. Harpegnathos saltator tRNA-Gln
  292. Heliconius melpomene (Postman butterfly) tRNA HMEL014838
  293. Helicoverpa armigera (Cotton bollworm) transfer RNA glutamine (anticodon UUG)
  294. Helicoverpa zea (Corn earworm) tRNA-Gln
  295. Heliothis virescens (tobacco budworm) tRNA
  296. Hemibagrus wyckioides tRNA
  297. Herpetotheres cachinnans tRNA
  298. Heterocephalus glaber tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  299. Heterotrigona itama tRNA
  300. Hippoglossus stenolepis (Pacific halibut) tRNA-Gln
  301. Hipposideros armiger tRNA
  302. Hirundo rustica rustica tRNA
  303. Homalodisca vitripennis (Glassy winged sharpshooter) tRNA-Gln
  304. Homo sapiens tRNA-Gln (anticodon TTG) 1-1 (TRQ-TTG1-1)
  305. Horornis vulcanius tRNA
  306. Hyalomma asiaticum (Tick) tRNA-Gln for anticodon UUG
  307. Hylaeus anthracinus (Anthricinan yellow-faced bee) transfer RNA glutamine (anticodon UUG)
  308. Hylaeus volcanicus (Volcano Masked Bee) transfer RNA glutamine (anticodon UUG)
  309. Hypocryptadius cinnamomeus tRNA
  310. Ichneumon xanthorius (Ichneumon Wasp) misc RNA ENSIXAG00005010634.1
  311. Ictidomys tridecemlineatus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  312. Ifrita kowaldi (blue-capped ifrita) tRNA
  313. Ignelater luminosus (cucubano) tRNA
  314. Illadopsis cleaveri (blackcap illadopsis) tRNA
  315. Ilyodon furcidens tRNA-Gln
  316. Indicator maculatus tRNA
  317. Irena cyanogastra Irena cyanogaster tRNA
  318. Ixodes persulcatus (Taiga tick) tRNA-Gln for anticodon UUG
  319. Ixodes scapularis tRNA-Gln
  320. Jacana jacana (wattled jacana) tRNA
  321. Jaculus jaculus (lesser Egyptian jerboa) tRNA
  322. Junco hyemalis (dark-eyed junco) tRNA
  323. Kryptolebias marmoratus (mangrove rivulus) tRNA
  324. Labeo rohita (rohu) tRNA
  325. Labrus bergylta (ballan wrasse) tRNA
  326. Ladona fulva tRNA
  327. Lamprotornis superbus tRNA
  328. Laodelphax striatellus (small brown planthopper) tRNA
  329. Larimichthys crocea tRNA
  330. Larus smithsonianus tRNA
  331. Lasius niger tRNA
  332. Lates calcarifer (barramundi perch) tRNA
  333. Latimeria chalumnae tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1, tRNA-Gln-TTG-1-2)
  334. Leguminivora glycinivorella tRNA-Gln
  335. Leiothrix lutea (red-billed leiothrix) tRNA
  336. Lepidothrix coronata tRNA
  337. Lepisosteus oculatus (spotted gar) tRNA
  338. Leptobrachium leishanense (Leishan spiny toad) tRNA
  339. Leptocoma aspasia tRNA
  340. Leptonychotes weddellii (Weddell seal) tRNA
  341. Leucopsar rothschildi tRNA
  342. Limulus polyphemus tRNA-Gln
  343. Linepithema humile tRNA-Gln
  344. Lineus longissimus (Bootlace worm) misc RNA ENSLLNG00015025189.1
  345. Lingula anatina tRNA-Gln
  346. Liparis tanakae tRNA
  347. Lipotes vexillifer (Yangtze River dolphin) tRNA
  348. Helopsaltes ochotensis Locustella ochotensis tRNA
  349. Lonchura striata tRNA
  350. Desmophyllum pertusum Lophelia pertusa tRNA
  351. Lophotis ruficrista tRNA
  352. Loxia curvirostra tRNA
  353. Loxodonta africana tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1, tRNA-Gln-TTG-1-2)
  354. Lupinus angustifolius (narrow-leaved blue lupine) tRNA
  355. Lynx canadensis (Canada lynx) tRNA
  356. Lynx pardinus (Spanish lynx) tRNA
  357. Macaca fascicularis (crab-eating macaque) tRNA
  358. Macaca mulatta tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  359. Macaca nemestrina (pig-tailed macaque) tRNA
  360. Macrosteles quadrilineatus (Aster leafhopper) transfer RNA glutamine (anticodon UUG)
  361. Malurus elegans (Red-winged fairywren) tRNA
  362. Mandrillus leucophaeus (drill) tRNA
  363. Manduca sexta tRNA-Gln
  364. Marmota marmota marmota (Alpine marmot) tRNA
  365. Marmota monax (woodchuck) tRNA
  366. Mastacembelus armatus tRNA
  367. Mauremys mutica tRNA
  368. Maylandia zebra (zebra mbuna) tRNA
  369. Megachile rotundata tRNA-Gln
  370. Megalops atlanticus tRNA
  371. Melanaphis sacchari (Sugarcane aphid) tRNA-Gln
  372. Meleagris gallopavo tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  373. Melipona bicolor tRNA
  374. Melipona quadrifasciata tRNA
  375. Melitaea cinxia (Glanville fritillary) misc RNA ENSMCXG00005023295.1
  376. Melospiza melodia (song sparrow) tRNA
  377. Menidia menidia (Atlantic silverside) tRNA
  378. Menura novaehollandiae (superb lyrebird) tRNA
  379. Merluccius polli (Benguela hake) tRNA
  380. Mesocricetus auratus (golden hamster) tRNA
  381. Microcaecilia unicolor tRNA
  382. Microcebus murinus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  383. Microctonus aethiopoides tRNA
  384. Microctonus hyperodae tRNA
  385. Microplitis demolitor (Parasitoid wasp) transfer RNA glutamine (anticodon UUG)
  386. Microplitis mediator (Endoparasitoid wasp) transfer RNA glutamine (anticodon UUG)
  387. Microtus ochrogaster (prairie vole) tRNA
  388. Mionectes macconnelli (McConnell's flycatcher) tRNA
  389. Mola mola (ocean sunfish) tRNA
  390. Molorchus minor tRNA-OTHER
  391. Molossus molossus (Pallas's mastiff bat) tRNA
  392. Molothrus ater tRNA
  393. Neomonachus schauinslandi Monachus schauinslandi (Hawaiian monk seal) tRNA
  394. Monodelphis domestica tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  395. Monodon monoceros (narwhal) tRNA
  396. Monomorium pharaonis (Pharaoh ant) tRNA-Gln
  397. Moschus moschiferus (Siberian musk deer) tRNA
  398. Muntiacus reevesi (Chinese muntjac) tRNA
  399. Muraenolepis orangiensis (Patagonian moray cod) tRNA
  400. Mus caroli tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  401. Mus musculus castaneus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  402. Mus musculus domesticus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  403. Mus musculus musculus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  404. Mus musculus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  405. Mus pahari tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  406. Mus spicilegus (steppe mouse) tRNA
  407. Mus spretus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  408. Mustela putorius furo tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  409. Myiagra hebetior tRNA
  410. Myotis davidii tRNA
  411. Myotis lucifugus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  412. Myotis myotis tRNA
  413. Myripristis murdjan (pinecone soldierfish) tRNA
  414. Mystacornis crossleyi tRNA
  415. Nannospalax galili (Upper Galilee mountains blind mole rat) tRNA
  416. Nasonia vitripennis tRNA-Gln
  417. Nematostella vectensis (Starlet sea anemone) tRNA-Gln for anticodon UUG
  418. Neodiprion lecontei tRNA-Gln
  419. Neodiprion pinetum tRNA-Gln
  420. Neodrepanis coruscans (wattled asity) tRNA
  421. Neogobius melanostomus (round goby) tRNA
  422. Neolamprologus brichardi tRNA
  423. Neophocaena asiaeorientalis asiaeorientalis (yangtze finless porpoise) tRNA
  424. Neopipo cinnamomea tRNA
  425. Neotoma lepida tRNA
  426. Neogale vison Neovison vison tRNA
  427. Nesospiza acunhae tRNA
  428. Nezara viridula (southern green stink bug) tRNA
  429. Nicator chloris tRNA
  430. Nilaparvata lugens (Brown planthopper) tRNA-Gln
  431. Nomascus leucogenys tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1, tRNA-Gln-TTG-1-2)
  432. Nothobranchius furzeri tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1, tRNA-Gln-TTG-1-2)
  433. Nothoprocta perdicaria tRNA
  434. Notiomystis cincta tRNA
  435. Notodromas monacha tRNA
  436. Notothenia coriiceps (black rockcod) tRNA
  437. Nyctereutes procyonoides (raccoon dog) tRNA
  438. Nyctibius grandis tRNA
  439. Nycticryphes semicollaris tRNA
  440. Nyctiprogne leucopyga tRNA
  441. Nylanderia fulva tRNA
  442. Oceanites oceanicus tRNA
  443. Ochotona princeps tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1, tRNA-Gln-TTG-2-2)
  444. Octodon degus (degu) tRNA
  445. Odobenus rosmarus divergens (Pacific walrus) tRNA
  446. Odocoileus virginianus texanus tRNA
  447. Onthophagus taurus (Dung beetle) tRNA-Gln
  448. Onychorhynchus coronatus tRNA
  449. Onychostoma macrolepis tRNA
  450. Ooceraea biroi tRNA-Gln
  451. Operophtera brumata (winter moth) tRNA
  452. Orbicella faveolata tRNA-Gln
  453. Oreocharis arfaki tRNA
  454. Oreochromis aureus tRNA
  455. Oreochromis niloticus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1, tRNA-Gln-TTG-2-2)
  456. Oreotrochilus melanogaster tRNA
  457. Oriolus oriolus tRNA
  458. Ornithorhynchus anatinus (platypus) tRNA
  459. Orthonyx spaldingii (northern chowchilla) tRNA
  460. Orussus abietinus tRNA-Gln
  461. Orycteropus afer afer tRNA
  462. Oryctes borbonicus tRNA
  463. Oryctolagus cuniculus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1, tRNA-Gln-TTG-2-2)
  464. Oryzias javanicus tRNA
  465. Oryzias latipes tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  466. Oryzias melastigma (Indian medaka) tRNA
  467. Oryzias sinensis tRNA
  468. Ostrea edulis (European flat oyster) transfer RNA glutamine (anticodon UUG)
  469. Otolemur garnettii tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  470. Otus sunia (Oriental scops-owl) tRNA
  471. Ovis aries tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  472. Oxyruncus cristatus (sharpbill) tRNA
  473. Pachycephala philippinensis tRNA
  474. Pachyramphus minor tRNA
  475. Pangasianodon gigas tRNA-Gln
  476. Pangasianodon hypophthalmus tRNA
  477. Pangasius djambal tRNA-Gln
  478. Pan paniscus (pygmy chimpanzee) tRNA
  479. Panthera leo (lion) tRNA
  480. Panthera tigris altaica (Amur tiger) tRNA
  481. Pan troglodytes tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  482. Panurus biarmicus tRNA
  483. Papilio machaon tRNA
  484. Papilio xuthus tRNA
  485. Papio anubis tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  486. Sinosuthora webbiana Paradoxornis webbianus tRNA
  487. Pararge aegeria aegeria tRNA
  488. Pararge aegeria tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  489. Arctia plantaginis Parasemia plantaginis tRNA
  490. Parnassius apollo (apollo) tRNA
  491. Patagioenas fasciata monilis tRNA
  492. Pavo cristatus (Indian peafowl) tRNA
  493. Pectinophora gossypiella (Pink bollworm) transfer RNA glutamine (anticodon UUG)
  494. Pediculus humanus corporis tRNA tRNA-Gln
  495. Pelodiscus sinensis (Chinese softshell turtle) tRNA
  496. Pelusios castaneus tRNA
  497. Penelope pileata tRNA
  498. Perca flavescens tRNA
  499. Perca fluviatilis (European perch) tRNA
  500. Peromyscus maniculatus bairdii (prairie deer mouse) tRNA
  501. Peucedramus taeniatus (olive warbler) tRNA
  502. Phainopepla nitens tRNA
  503. Phascolarctos cinereus (koala) tRNA
  504. Pheucticus melanocephalus tRNA
  505. Phocoena sinus (vaquita) tRNA
  506. Photinus pyralis (common eastern firefly) tRNA
  507. Phrynocephalus forsythii tRNA
  508. Phyllostomus discolor (pale spear-nosed bat) tRNA
  509. Physeter macrocephalus Physeter catodon (sperm whale) tRNA
  510. Piaya cayana (squirrel cuckoo) tRNA
  511. Picathartes gymnocephalus tRNA
  512. Dryobates pubescens Picoides pubescens (downy woodpecker) tRNA
  513. Piliocolobus tephrosceles (Ugandan red Colobus) tRNA
  514. Pipistrellus kuhlii (Kuhl's pipistrelle) tRNA
  515. Pipra filicauda tRNA
  516. Pitta sordida (hooded pitta) tRNA
  517. Platysteira castanea tRNA
  518. Platysternon megacephalum (big-headed turtle) tRNA
  519. Plecturocebus cupreus tRNA-OTHER
  520. Pleuronectes platessa (European plaice) tRNA
  521. Ploceus nigricollis tRNA
  522. Plodia interpunctella (Indianmeal moth) transfer RNA glutamine (anticodon UUG)
  523. Plutella xylostella (diamondback moth) tRNA
  524. Pluvianellus socialis (magellanic plover) tRNA
  525. Pocillopora damicornis tRNA-Gln
  526. Podarcis lilfordi tRNA
  527. Podarcis muralis tRNA
  528. Podargus strigoides (tawny frogmouth) tRNA
  529. Podilymbus podiceps tRNA
  530. Poecile atricapillus Poecile atricapilla (Black-capped chickadee) tRNA
  531. Poecilia formosa tRNA
  532. Poecilia reticulata (guppy) tRNA
  533. Pogona vitticeps (central bearded dragon) tRNA
  534. Pogonomyrmex barbatus tRNA-Gln
  535. Polioptila caerulea tRNA
  536. Polistes canadensis (Red paper wasp) tRNA-Gln
  537. Polistes dominula tRNA-Gln
  538. Polistes fuscatus (Common paper wasp) tRNA-Gln
  539. Polyplax serrata tRNA-Gln
  540. Polypterus senegalus tRNA
  541. Pomacea canaliculata tRNA-Gln
  542. Pomatorhinus ruficollis tRNA
  543. Pomatostomus ruficeps (chestnut-crowned babbler) tRNA
  544. Pongo abelii tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  545. Potamilus streckersoni tRNA-Gln
  546. Probosciger aterrimus tRNA
  547. Procavia capensis tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  548. Prolemur simus (greater bamboo lemur) tRNA
  549. Promerops cafer (Cape sugarbird) tRNA
  550. Propithecus coquereli (Coquerel's sifaka) tRNA
  551. Prunella fulvescens tRNA
  552. Prunella himalayana tRNA
  553. Parambassis ranga Pseudambassis ranga (Indian glassy fish) tRNA
  554. Pseudoatta argentina tRNA
  555. Pseudonaja textilis tRNA
  556. Psilopogon haemacephalus tRNA
  557. Psophia crepitans (common trumpeter) tRNA
  558. Pterocles burchelli tRNA
  559. Pteropus alecto (black flying fox) tRNA
  560. Pteropus vampyrus (large flying fox) tRNA
  561. Pteruthius melanotis tRNA
  562. Puma concolor (puma) tRNA
  563. Pundamilia nyererei tRNA
  564. Brachypodius melanocephalos Pycnonotus atriceps tRNA
  565. Pycnonotus jocosus tRNA
  566. Python bivittatus Python molurus bivittatus (Burmese python) tRNA
  567. Quiscalus mexicanus tRNA
  568. Ramphastos sulfuratus tRNA
  569. Rattus norvegicus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  570. Rhabdornis inornatus tRNA
  571. Rhamnusium bicolor tRNA-Gln
  572. Rhinolophus ferrumequinum (greater horseshoe bat) tRNA
  573. Rhinopithecus bieti (Black snub-nosed monkey) tRNA
  574. Rhinopithecus roxellana (golden snub-nosed monkey) tRNA
  575. Rhinopomastus cyanomelas (common scimitar-bill) tRNA
  576. Rhipicephalus microplus (Southern cattle tick) tRNA-Gln
  577. Rhipicephalus sanguineus (Brown dog tick) transfer RNA glutamine (anticodon UUG)
  578. Rhodinocichla rosea tRNA
  579. Rhodnius prolixus (Kissing bug) tRNA tRNA-Gln
  580. Rhopalosiphum maidis tRNA-Gln
  581. Rousettus aegyptiacus (Egyptian rousette) tRNA
  582. Saccoglossus kowalevskii (Acorn worm) tRNA-Gln
  583. Sagittarius serpentarius tRNA
  584. Saimiri boliviensis boliviensis tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  585. Sakesphorus luctuosus tRNA
  586. Salarias fasciatus (jewelled blenny) tRNA
  587. Sander lucioperca (pike-perch) tRNA
  588. Sapayoa aenigma (broad-billed sapayoa) tRNA
  589. Sarcophilus harrisii (Tasmanian devil) tRNA
  590. Schistocerca americana tRNA-Gln
  591. Schistocerca cancellata (South American locust) transfer RNA glutamine (anticodon UUG)
  592. Schistocerca gregaria (Grasshoppers) transfer RNA glutamine (anticodon UUG)
  593. Schistocerca nitens (Vagrant locust) transfer RNA glutamine (anticodon UUG)
  594. Schistocerca piceifrons (Central American locust) tRNA-Gln
  595. Schistocerca serialis cubense (Grasshoppers) transfer RNA glutamine (anticodon UUG)
  596. Sciurus carolinensis (gray squirrel) tRNA
  597. Sciurus vulgaris (Eurasian red squirrel) tRNA
  598. Scleropages formosus tRNA
  599. Sclerurus mexicanus (tawny-throated leaftosser) tRNA
  600. Scophthalmus maximus (turbot) tRNA
  601. Scopus umbretta (hamerkop) tRNA
  602. Scyliorhinus torazame (cloudy catshark) tRNA
  603. Scytalopus superciliaris tRNA
  604. Semnornis frantzii tRNA
  605. Acanthosepion pharaonis Sepia pharaonis tRNA
  606. Serilophus lunatus (silver-breasted broadbill) tRNA
  607. Silurus meridionalis tRNA
  608. Sinocyclocheilus anshuiensis tRNA
  609. Sinocyclocheilus grahami tRNA
  610. Sinocyclocheilus rhinocerous tRNA
  611. Sipha flava tRNA-Gln
  612. Sitta europaea (wood nuthatch) tRNA
  613. Solenopsis invicta (red fire ant) tRNA
  614. Sousa chinensis (Indo-pacific humpbacked dolphin) tRNA
  615. Sparus aurata (gilthead seabream) tRNA
  616. Spermophilus dauricus (Daurian ground squirrel) tRNA
  617. Urocitellus parryii Spermophilus parryii (Arctic ground squirrel) tRNA
  618. Sphaeramia orbicularis tRNA
  619. Sphaerodactylus townsendi tRNA-Gln
  620. Sphenodon punctatus (tuatara) tRNA
  621. Spizaetus tyrannus (black hawk-eagle) tRNA
  622. Spizella passerina (chipping sparrow) tRNA
  623. Spodoptera exigua (beet armyworm) tRNA
  624. Spodoptera frugiperda tRNA-Gln (TTG) (tRNA-Gln-TTG-1 1 to 3)
  625. Spodoptera littoralis tRNA
  626. Spodoptera litura tRNA
  627. Steatornis caripensis (oilbird) tRNA
  628. Stegastes partitus (bicolor damselfish) tRNA
  629. Stegodyphus dumicola tRNA-Gln
  630. Stercorarius parasiticus tRNA
  631. Strigamia maritima tRNA
  632. Strigops habroptila (kakapo) tRNA
  633. Strix occidentalis caurina tRNA
  634. Stylophora pistillata (Hood coral) tRNA-Gln
  635. Sula dactylatra tRNA
  636. Suricata suricatta (meerkat) tRNA
  637. Sus scrofa tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  638. Sylvia borin tRNA
  639. Synaphobranchus kaupii (Kaup's arrowtooth eel) tRNA
  640. Syrrhaptes paradoxus (Pallas's sandgrouse) tRNA
  641. Taeniopygia guttata tRNA
  642. Takifugu bimaculatus tRNA
  643. Takifugu flavidus tRNA
  644. Takifugu rubripes tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1, tRNA-Gln-TTG-1-2)
  645. Temnothorax curvispinosus tRNA
  646. Temnothorax longispinosus tRNA
  647. Tenebrio molitor (yellow mealworm) tRNA
  648. Terrapene triunguis Terrapene carolina triunguis (three-toed box turtle) tRNA
  649. Tetraodon nigroviridis tRNA
  650. Theropithecus gelada (gelada baboon) tRNA
  651. Thinocorus orbignyianus tRNA
  652. Thrips palmi tRNA-Gln
  653. Tinamus guttatus tRNA
  654. Todus mexicanus (puerto rican tody) tRNA
  655. Toxostoma redivivum tRNA
  656. Trachymyrmex cornetzi tRNA
  657. Trachymyrmex septentrionalis tRNA
  658. Mycetomoellerius zeteki Trachymyrmex zeteki tRNA
  659. Trialeurodes vaporariorum (Greenhouse whitefly) tRNA-Gln for anticodon UUG
  660. Tribolium castaneum tRNA-Gln for anticodon UUG
  661. Tribolium madens (Black flour beetle) tRNA-Gln
  662. Trichechus manatus latirostris tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  663. Trichogramma brassicae tRNA
  664. Trichogramma pretiosum (Parasitoid wasp) tRNA-Gln
  665. Tricholaema leucomelas (pied barbet) tRNA
  666. Trichomalopsis sarcophagae tRNA
  667. Trichoplusia ni (cabbage looper) tRNA
  668. Triplophysa rosa (cave loach) tRNA
  669. Triplophysa tibetana tRNA
  670. Tupaia chinensis (Chinese tree shrew) tRNA
  671. Salvator merianae Tupinambis merianae tRNA
  672. Turnix velox (little buttonquail) tRNA
  673. Tursiops truncatus (bottlenosed dolphin) tRNA
  674. Tyrannus savana (fork-tailed flycatcher) tRNA
  675. Uloborus diversus (Orb Weaver) transfer RNA glutamine (anticodon UUG)
  676. Upupa epops (Eurasian hoopoe) tRNA
  677. Urocolius indicus tRNA
  678. Urocynchramus pylzowi tRNA
  679. Orthopoxvirus vaccinia URQ-UUG1-1 tRNA (72-MER) from Vaccinia virus (PDB 9FPY, chain U)
  680. Ursus americanus (American black bear) tRNA
  681. Ursus maritimus (polar bear) tRNA
  682. Vanessa tameamea tRNA
  683. Varanus komodoensis tRNA
  684. Venturia canescens tRNA-Gln
  685. Vespula germanica tRNA
  686. Vespula pensylvanica (western yellowjacket) tRNA
  687. Vespula vulgaris tRNA
  688. Vicugna pacos tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  689. Vidua chalybeata tRNA
  690. Vidua macroura tRNA
  691. Vombatus ursinus (common wombat) tRNA
  692. Vulpes vulpes (red fox) tRNA
  693. Xenoophorus captivus tRNA-Gln
  694. Xenotaenia resolanae tRNA-Gln
  695. Xiphophorus maculatus (southern platyfish) tRNA
  696. Xiphorhynchus elegans (elegant woodcreeper) tRNA
  697. Zapornia atra tRNA
  698. Zootermopsis nevadensis tRNA-Gln (TTG) (tRNA-Gln-TTG-1 1 to 3)
  699. Zophobas morio tRNA
  700. Zosterops borbonicus tRNA
Relationships

Molecular Relationships

2D structure

Loading 2D structure...