Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-206-3p URS000034B6F5_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-206: rno-mir-206 is a muscle-specific miRNA that plays a crucial role in muscle cell proliferation, differentiation, apoptosis, migration, and angiogenesis [PMC5270432]. Increased expression levels of rno-mir-206 in cerebral ischemia have been associated with the progression of injury [PMC5270432]. However, marginal downregulation of rno-mir-206 and rno-miR-494-3p at 6 hours post ischemia may contribute to the promotion of recovery [PMC5270432]. In a rat model of cerebral ischemia, underexpression of rno-mir-206 at 72 hours post MCAO was observed, leading to neurogenesis and explaining the spontaneous recovery observed in the rat model [PMC5270432]. Overexpression of rno-mir-206 was found to inhibit neural cell viability [PMC5270432]. Other miRNAs such as miR-214, miR-223, miR-298, miR-327, and miR-494 have also been reported to be overexpressed during ischemia/reperfusion periods in rat models [PMC7555634]. Expression levels of rno-mir-206 correlated well with infarct volumes in a rat model with high R values [PMC3688919]. Expression levels of rno-mir-206 increased from 0 hrs to 24 hrs and gradually decreased from 48 hrs to 168 hrs post-ischemia/reperfusion [PMC3688919]. Rno-mir-206 is known to be abundant in muscle tissue but has also been reported in the rat hippocampus and striatum [PMC9833481]. Additionally, rno-miR-183/96, rno-miR30b,rn0o-rmi-R150,andrnomi-Rn6o-were foundtodysregulatedin two or more studies, suggesting that various factors could influence miRNA expression [PMC10045079].

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAAUGUAAGGAAGUGUGUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 52 other species

  1. Alligator mississippiensis (American alligator) ami-miR-206-3p
  2. Anolis carolinensis (green anole) Aca-Mir-1-P2_3p (mature (guide))
  3. Bos taurus (cattle) bta-miR-206
  4. Callithrix jacchus cja-miR-206
  5. Canis lupus familiaris (dog) cfa-miR-206
  6. Cavia porcellus (domestic guinea pig) cpo-miR-206-3p
  7. Chrysemys picta bellii (western painted turtle) Cpi-Mir-1-P2_3p (mature (guide))
  8. Chrysemys picta (Painted turtle) cpi-miR-206-3p
  9. Columba livia cli-miR-206-3p
  10. Cricetulus griseus cgr-miR-206
  11. Cyprinus carpio (common carp) ccr-miR-206
  12. Danio rerio dre-miR-206-3p
  13. Dasypus novemcinctus dno-miR-206-3p
  14. Echinops telfairi Ete-Mir-1-P2_3p (mature (guide))
  15. Equus caballus (horse) eca-miR-206
  16. Gadus morhua gmo-miR-206-3p
  17. Gallus gallus (chicken) gga-miR-206
  18. Gekko japonicus Gja-Mir-1-P2f_3p (mature (guide))
  19. Gorilla gorilla gorilla ggo-miR-206 (MIR206)
  20. Gorilla gorilla (western gorilla) ggo-miR-206
  21. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-206
  22. Homo sapiens hsa-miR-206
  23. Ictalurus punctatus ipu-miR-206
  24. Latimeria chalumnae Lch-Mir-1-P2_3p (mature (guide))
  25. Lepisosteus oculatus Loc-Mir-1-P2_3p (mature (guide))
  26. Macaca mulatta mml-miR-206
  27. Macaca nemestrina mne-miR-206
  28. Maylandia zebra (zebra mbuna) mze-miR-206
  29. Microcaecilia unicolor Mun-Mir-1-P2_3p (mature (guide))
  30. Monodelphis domestica Mdo-Mir-1-P2_3p (mature (guide))
  31. Monopterus albus Mal-Mir-1-P2a_3p (mature (guide))
  32. Mus musculus mmu-miR-206-3p
  33. Neolamprologus brichardi nbr-miR-206
  34. Ophiophagus hannah (king cobra) oha-miR-206
  35. Oreochromis niloticus oni-miR-206
  36. Ornithorhynchus anatinus (platypus) oan-miR-206-3p
  37. Oryctolagus cuniculus ocu-miR-206-3p
  38. Ovis aries Pri-miR206
  39. Pan troglodytes ptr-miR-206
  40. Paralichthys olivaceus pol-miR-206-3p
  41. Pongo pygmaeus (Bornean orangutan) ppy-miR-206
  42. Pteropus alecto (black flying fox) pal-miR-206-3p
  43. Pundamilia nyererei pny-miR-206
  44. Python bivittatus (Burmese python) pbv-miR-206-3p
  45. Salmo salar ssa-miR-206-3p
  46. Sarcophilus harrisii Sha-Mir-1-P2_3p (mature (guide))
  47. Sphenodon punctatus Spt-Mir-1-P2_3p (mature (guide))
  48. Taeniopygia guttata Tgu-Mir-1-P2_3p (mature (guide))
  49. Tetraodon nigroviridis Tni-Mir-1-P2a_3p (mature (guide))
  50. Tor tambroides (Thai mahseer) miR-206-3p
  51. Xenopus laevis (African clawed frog) xla-miR-206-3p
  52. Xenopus tropicalis xtr-miR-206
Publications