Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Dasypus novemcinctus (nine-banded armadillo) dno-miR-206-3p URS000034B6F5_9361

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAAUGUAAGGAAGUGUGUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 52 other species

  1. Alligator mississippiensis (American alligator) ami-miR-206-3p
  2. Anolis carolinensis (green anole) Aca-Mir-1-P2_3p (mature (guide))
  3. Bos taurus (cattle) bta-miR-206
  4. Callithrix jacchus cja-miR-206
  5. Canis lupus familiaris (dog) cfa-miR-206
  6. Cavia porcellus (domestic guinea pig) cpo-miR-206-3p
  7. Chrysemys picta bellii (western painted turtle) Cpi-Mir-1-P2_3p (mature (guide))
  8. Chrysemys picta (Painted turtle) cpi-miR-206-3p
  9. Columba livia cli-miR-206-3p
  10. Cricetulus griseus cgr-miR-206
  11. Cyprinus carpio (common carp) ccr-miR-206
  12. Danio rerio dre-miR-206-3p
  13. Echinops telfairi Ete-Mir-1-P2_3p (mature (guide))
  14. Equus caballus (horse) eca-miR-206
  15. Gadus morhua gmo-miR-206-3p
  16. Gallus gallus (chicken) gga-miR-206
  17. Gekko japonicus Gja-Mir-1-P2f_3p (mature (guide))
  18. Gorilla gorilla gorilla ggo-miR-206 (MIR206)
  19. Gorilla gorilla (western gorilla) ggo-miR-206
  20. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-206
  21. Homo sapiens hsa-miR-206
  22. Ictalurus punctatus ipu-miR-206
  23. Latimeria chalumnae Lch-Mir-1-P2_3p (mature (guide))
  24. Lepisosteus oculatus Loc-Mir-1-P2_3p (mature (guide))
  25. Macaca mulatta mml-miR-206
  26. Macaca nemestrina mne-miR-206
  27. Maylandia zebra (zebra mbuna) mze-miR-206
  28. Microcaecilia unicolor Mun-Mir-1-P2_3p (mature (guide))
  29. Monodelphis domestica Mdo-Mir-1-P2_3p (mature (guide))
  30. Monopterus albus Mal-Mir-1-P2a_3p (mature (guide))
  31. Mus musculus mmu-miR-206-3p
  32. Neolamprologus brichardi nbr-miR-206
  33. Ophiophagus hannah (king cobra) oha-miR-206
  34. Oreochromis niloticus oni-miR-206
  35. Ornithorhynchus anatinus (platypus) oan-miR-206-3p
  36. Oryctolagus cuniculus ocu-miR-206-3p
  37. Ovis aries Pri-miR206
  38. Pan troglodytes ptr-miR-206
  39. Paralichthys olivaceus pol-miR-206-3p
  40. Pongo pygmaeus (Bornean orangutan) ppy-miR-206
  41. Pteropus alecto (black flying fox) pal-miR-206-3p
  42. Pundamilia nyererei pny-miR-206
  43. Python bivittatus (Burmese python) pbv-miR-206-3p
  44. Rattus norvegicus rno-miR-206-3p
  45. Salmo salar ssa-miR-206-3p
  46. Sarcophilus harrisii Sha-Mir-1-P2_3p (mature (guide))
  47. Sphenodon punctatus Spt-Mir-1-P2_3p (mature (guide))
  48. Taeniopygia guttata Tgu-Mir-1-P2_3p (mature (guide))
  49. Tetraodon nigroviridis Tni-Mir-1-P2a_3p (mature (guide))
  50. Tor tambroides (Thai mahseer) miR-206-3p
  51. Xenopus laevis (African clawed frog) xla-miR-206-3p
  52. Xenopus tropicalis xtr-miR-206