Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) Rno-Mir-208-P1_3p (mature (guide)) URS000034979B_10116

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUAAGACGAACAAAAGGUUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Bos taurus (cattle) bta-miR-208b
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-208b
  3. Canis lupus familiaris (dog) cfa-miR-208b
  4. Cavia porcellus cpo-miR-208b-3p
  5. Dasypus novemcinctus (nine-banded armadillo) dno-miR-208b-3p
  6. Echinops telfairi Ete-Mir-208-P1b_3p (mature (guide))
  7. Equus caballus eca-miR-208b
  8. Homo sapiens (human) hsa-miR-208b-3p
  9. Macaca mulatta mml-miR-208b-3p
  10. Monodelphis domestica (gray short-tailed opossum) mdo-miR-208b-3p
  11. Mus musculus mmu-miR-208b-3p
  12. Oryctolagus cuniculus (rabbit) ocu-miR-208b-3p
  13. Pan troglodytes (chimpanzee) ptr-miR-208b
  14. Pongo pygmaeus (Bornean orangutan) ppy-miR-208b
  15. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-208-P1_3p (mature (guide))
  16. Sus scrofa ssc-miR-208b