Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Monodelphis domestica (gray short-tailed opossum) mdo-miR-208b-3p URS000034979B_13616

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUAAGACGAACAAAAGGUUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Bos taurus (cattle) bta-miR-208b
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-208b
  3. Canis lupus familiaris (dog) cfa-miR-208b
  4. Cavia porcellus cpo-miR-208b-3p
  5. Dasypus novemcinctus (nine-banded armadillo) dno-miR-208b-3p
  6. Echinops telfairi Ete-Mir-208-P1b_3p (mature (guide))
  7. Equus caballus eca-miR-208b
  8. Homo sapiens (human) hsa-miR-208b-3p
  9. Macaca mulatta mml-miR-208b-3p
  10. Mus musculus mmu-miR-208b-3p
  11. Oryctolagus cuniculus (rabbit) ocu-miR-208b-3p
  12. Pan troglodytes (chimpanzee) ptr-miR-208b
  13. Pongo pygmaeus (Bornean orangutan) ppy-miR-208b
  14. Rattus norvegicus (Norway rat) Rno-Mir-208-P1_3p (mature (guide))
  15. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-208-P1_3p (mature (guide))
  16. Sus scrofa ssc-miR-208b
Publications