Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-208b-3p URS000034979B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-208b: Hsa-mir-208b is a microRNA that has been studied in various contexts. In a comparison between T2 asthma and health control groups, hsa-mir-208b was found to be down-regulated [PMC9035528]. It has been identified as a potential binding site in the 3' UTR sequence of IFNL3-T and IFNL2 [PMC4183367]. The expression of hsa-mir-208b was quantified using miRCURY LNA Universal RT microRNA PCR assays [PMC4183367]. While some studies have reported high heart-specificity for hsa-mir-208b, others have not identified it as a tissue-specific miRNA [PMC2635472]. It has also been predicted to be specific to the heart, skeletal muscle, and tongue [PMC2635472]. Hsa-mir-208b has been implicated in heart failure and targets genes in the p53 signaling pathway [PMC6231654]. In some studies, hsa-mir-208b was not confirmed as a microRNA of interest [PMC5675613]. It has also been associated with lung neoplasms and evaluated as a biomarker for acute myocardial infarction (AMI) and heart failure prognosis [PMC5357838] [PMC6406975] [PMC9688392]. Among miRNAs specifically expressed in skeletal muscle, hsa-mir-208b was found to be up-regulated only in plasma of trained subjects. This suggests its potential role as a myo-miRNA biomarker for exercise training adaptation.

mRNA interactions 5 total

Genome locations

Gene Ontology annotations

Localisation

No annotated location

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUAAGACGAACAAAAGGUUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

Publications