v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sarcophilus harrisii (Tasmanian devil) Sha-Mir-208-P1_3p (mature (guide)) URS000034979B_9305

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AUAAGACGAACAAAAGGUUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Bos taurus (cattle) bta-miR-208b
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-208b
  3. Canis lupus familiaris (dog) cfa-miR-208b
  4. Cavia porcellus cpo-miR-208b-3p
  5. Dasypus novemcinctus (nine-banded armadillo) dno-miR-208b-3p
  6. Echinops telfairi Ete-Mir-208-P1b_3p (mature (guide))
  7. Equus caballus eca-miR-208b
  8. Homo sapiens (human) hsa-miR-208b-3p
  9. Macaca mulatta mml-miR-208b-3p
  10. Monodelphis domestica (gray short-tailed opossum) mdo-miR-208b-3p
  11. Mus musculus mmu-miR-208b-3p
  12. Oryctolagus cuniculus (rabbit) ocu-miR-208b-3p
  13. Pan troglodytes (chimpanzee) ptr-miR-208b
  14. Pongo pygmaeus (Bornean orangutan) ppy-miR-208b
  15. Rattus norvegicus (Norway rat) Rno-Mir-208-P1_3p (mature (guide))
  16. Sus scrofa ssc-miR-208b