Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-208b-3p URS000034979B_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (MirGeneDB, MalaCards, RefSeq, GeneCards, PSICQUIC, ENA, miRBase, TarBase). Described in 29 papers. Homo sapiens (human) hsa-miR-208b-3p sequence is a product of hsa-miR-208b-3p, MIR208B, miR-208b-3p, hsa-miR-208b, miR-208b, miR-208 genes. Found in the human reference genome. Interacts with protein-coding genes, including CAP20, CDKN1, CDKN1A, CIP1, ENSG00000124762, P21, SDI1, WAF1, p21CIP1, p21Cip1/Waf1.

Interactions 10

According to PSICQUIC, Homo sapiens (human) hsa-miR-208b-3p interacts with:

Interaction id Participant Synonyms
URS000034979B_9606-0 O14793 O14793
URS000034979B_9606-5 O14793 O14793
URS000034979B_9606-1 P38936 P38936
URS000034979B_9606-6 P38936 P38936
URS000034979B_9606-2 Q08289 Q08289
URS000034979B_9606-7 Q08289 Q08289
URS000034979B_9606-8 Q13936 Q13936
URS000034979B_9606-3 Q13936 Q13936
URS000034979B_9606-4 Q9UHV7 Q9UHV7
URS000034979B_9606-9 Q9UHV7 Q9UHV7

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AUAAGACGAACAAAAGGUUUGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 26 other species

    1. Bos taurus (cattle) bta-miR-208b
    2. Callithrix jacchus cja-miR-208b
    3. Canis lupus familiaris cfa-miR-208b
    4. Cavia porcellus (domestic guinea pig) cpo-miR-208b-3p
    5. Dasypus novemcinctus (nine-banded armadillo) dno-miR-208b-3p
    6. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-208-P2b_3p (mature (guide))
    7. Equus caballus (horse) eca-miR-208b
    8. Macaca mulatta mml-miR-208b-3p
    9. Monodelphis domestica mdo-miR-208b-3p
    10. Mus musculus (house mouse) mmu-miR-208b-3p
    11. Oryctolagus cuniculus (rabbit) ocu-miR-208b-3p
    12. Pan troglodytes (chimpanzee) ptr-miR-208b
    13. Pongo pygmaeus ppy-miR-208b
    14. Rattus norvegicus Rno-Mir-208-P2_3p (mature (guide))
    15. Sarcophilus harrisii Sha-Mir-208-P2_3p (mature (guide))
    16. Sus scrofa ssc-miR-208b