Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Cordylochernes scorpioides tRNA-Gly secondary structure diagram

Cordylochernes scorpioides tRNA-Gly URS00003429B0_51811

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCAUCGGUGGUUCAGUGGUAGAAUGCUCGCCUGCCACGCGGGCGGCCCGGGUUCGAUUCCCGGCCGAUGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 341 other species

  1. Acanthocheilonema viteae tRNA
  2. Acanthoscelides obtectus tRNA
  3. Acrobeloides nanus tRNA
  4. Acromyrmex charruanus tRNA
  5. Acromyrmex echinatior (Panamanian leaf-cutter ant) tRNA-Gly
  6. Acromyrmex heyeri tRNA
  7. Aedes aegypti tRNA AAEL018917
  8. Aedes albopictus tRNA tRNA-Gly
  9. Aethina tumida (Small hive beetle) transfer RNA glycine (anticodon GCC)
  10. Agrilus planipennis tRNA-Gly
  11. Amblyteles armatorius (Ichneumon Wasp) misc RNA ENSAAYG00000011479.1
  12. Amphibalanus amphitrite tRNA-Gly
  13. Amyelois transitella tRNA-Gly
  14. Anastrepha ludens (Mexican fruit fly) transfer RNA glycine (anticodon GCC)
  15. Anastrepha obliqua (WestIndian fruit fly) transfer RNA glycine (anticodon GCC)
  16. Ancistrocerus nigricornis (Potter wasp) misc RNA ENSANRG00000012438.1
  17. Ancylostoma caninum (dog hookworm) tRNA
  18. Ancylostoma ceylanicum tRNA
  19. Ancylostoma duodenale tRNA
  20. Anisakis simplex (herring worm) tRNA
  21. Anopheles albimanus tRNA
  22. Anopheles arabiensis tRNA tRNA-Gly
  23. Anopheles atroparvus tRNA
  24. Anopheles christyi (Mosquito) tRNA tRNA-Gly
  25. Anopheles coluzzii (Mosquito) tRNA-Gly for anticodon GCC
  26. Anopheles culicifacies tRNA tRNA-Gly
  27. Anopheles darlingi (American malaria mosquito) tRNA ADAC010736
  28. Anopheles dirus (Mosquito) tRNA tRNA-Gly
  29. Anopheles epiroticus (Mosquito) tRNA tRNA-Gly
  30. Anopheles farauti tRNA tRNA-Gly
  31. Anopheles funestus (African malaria mosquito) tRNA-Gly for anticodon GCC
  32. Anopheles gambiae (African malaria mosquito) tRNA tRNA-Gly
  33. Anopheles gambiae str. PEST tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 16)
  34. Anopheles maculatus (Mosquito) tRNA tRNA-Gly
  35. Anopheles melas (Mosquito) tRNA tRNA-Gly
  36. Anopheles merus tRNA tRNA-Gly
  37. Anopheles minimus (Mosquito) tRNA tRNA-Gly
  38. Anopheles quadriannulatus (Mosquito) tRNA tRNA-Gly
  39. Anopheles sinensis (Mosquito) tRNA tRNA-Gly
  40. Anopheles stephensi tRNA tRNA-Gly
  41. Anthonomus grandis grandis (Boll weevil) transfer RNA glycine (anticodon GCC)
  42. Apis cerana cerana tRNA
  43. Apis dorsata tRNA-Gly
  44. Apis florea tRNA-Gly
  45. Apis mellifera tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 6)
  46. Apolygus lucorum tRNA
  47. Arabis alpina (gray rockcress) tRNA
  48. Araneus ventricosus tRNA
  49. Argiope bruennichi tRNA
  50. Aromia moschata tRNA-OTHER
  51. Asbolus verrucosus (desert ironclad beetle) tRNA
  52. Athalia rosae (Coleseed sawfly) misc RNA ENSAEAG00005006728.1
  53. Atta cephalotes tRNA LOC105616975-2
  54. Atta colombica tRNA
  55. Bactrocera dorsalis tRNA-Gly
  56. Bactrocera latifrons (Solanum fruit fly) tRNA-Gly
  57. Bactrocera neohumeralis (Lesser Queensland fruit fly) transfer RNA glycine (anticodon GCC)
  58. Bactrocera tryoni tRNA-Gly
  59. Bicyclus anynana (Squinting bush brown) tRNA-Gly
  60. Blattella germanica tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 19)
  61. Bombus affinis (Rusty patched bumble bee) transfer RNA glycine (anticodon GCC)
  62. Bombus huntii (Hunt's bumblebee) transfer RNA glycine (anticodon GCC)
  63. Bombus terrestris (Buff-tailed bumblebee) tRNA LOC110119263
  64. Bombus vancouverensis nearcticus (Montane Bumble Bee) tRNA-Gly
  65. Bombus vosnesenskii tRNA
  66. Bombyx mandarina (Wild silkworm) tRNA-Gly
  67. Bombyx mori tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 27)
  68. Pseudolycoriella hygida Bradysia hygida tRNA
  69. Brassicogethes aeneus (rape pollen beetle) tRNA
  70. Brenthis ino (lesser marbled fritillary) tRNA
  71. Brugia malayi tRNA
  72. Brugia pahangi tRNA
  73. Brugia timori tRNA
  74. Caenorhabditis auriculariae tRNA
  75. Caenorhabditis sp. 36 PRJEB53466 tRNA
  76. Caerostris darwini tRNA-Gly
  77. Caerostris extrusa tRNA-Gly
  78. Callosobruchus analis hypothetical protein
  79. Callosobruchus chinensis hypothetical protein
  80. Callosobruchus maculatus (cowpea weevil) tRNA
  81. Camponotus floridanus tRNA-Gly
  82. Capitella teleta (Bristle worm) tRNA-Gly for anticodon GCC
  83. Cataglyphis hispanica (Desert ant) transfer RNA glycine (anticodon GCC)
  84. Centruroides sculpturatus (Bark scorpion) tRNA-Gly
  85. Cephus cinctus (wheat stem sawfly) tRNA
  86. Ceratitis capitata tRNA-Gly
  87. Cercopithifilaria johnstoni tRNA
  88. Ceutorhynchus assimilis (cabbage seed weevil) tRNA
  89. Chelonus insularis (Parasitoid wasp) tRNA-Gly
  90. Chrysodeixis includens tRNA
  91. Cimex lectularius tRNA-Gly
  92. Cloeon dipterum tRNA
  93. Copidosoma floridanum tRNA-Gly
  94. Coptotermes formosanus (Formosan subterranean termite) tRNA
  95. Coremacera marginata (Sieve-winged Snailkiller) misc RNA ENSCNRG00005015268.1
  96. Magallana angulata Crassostrea angulata (Portuguese oyster) transfer RNA glycine (anticodon GCC)
  97. Magallana gigas (Pacific oyster) tRNA-Gly for anticodon GCC
  98. Crassostrea virginica (Eastern oyster) tRNA-Gly
  99. Cryptolaemus montrouzieri tRNA-Gly
  100. Cryptotermes secundus tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 4)
  101. Ctenocephalides felis (Cat flea) tRNA-Gly
  102. Culex pipiens pallens (Northern house mosquito) transfer RNA glycine (anticodon GCC)
  103. Culex quinquefasciatus tRNA-Gly
  104. Cyanobacteria bacterium J06638_20 tRNA-Gly
  105. Cylas formicarius (Sweet potato weevil) transfer RNA glycine (anticodon GCC)
  106. Cylicocyclus nassatus tRNA
  107. Cyphomyrmex costatus tRNA
  108. Danaus chrysippus (African queen) tRNA
  109. Danaus plexippus plexippus tRNA
  110. Darwinula stevensoni tRNA
  111. Diabrotica balteata tRNA
  112. Diabrotica virgifera virgifera transfer RNA glycine (anticodon GCC)
  113. Diatraea saccharalis (sugarcane borer) tRNA
  114. Dicrurus megarhynchus tRNA
  115. Dinoponera quadriceps (south american ant) tRNA
  116. Diorhabda carinulata (Northern tamarisk beetle) transfer RNA glycine (anticodon GCC)
  117. Diorhabda sublineata (Subtropical tamarisk beetle) transfer RNA glycine (anticodon GCC)
  118. Dolichomitus sp. PSUC_FEM 10030005 tRNA
  119. Dreissena polymorpha (Zebra mussel) transfer RNA glycine (anticodon GCC)
  120. Drosophila albomicans (Fruit fly) transfer RNA glycine (anticodon GCC)
  121. Drosophila ananassae tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 15)
  122. Drosophila arizonae (Fruit fly) tRNA-Gly
  123. Drosophila biarmipes (Fruit fly) transfer RNA glycine (anticodon GCC)
  124. Drosophila bipectinata (Fruit fly) tRNA-Gly
  125. Drosophila busckii (Fruit fly) tRNA-Gly
  126. Drosophila elegans (Fruit fly) tRNA-Gly
  127. Drosophila erecta tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 13)
  128. Drosophila eugracilis (Fruit fly) tRNA-Gly
  129. Drosophila ficusphila (Fruit fly) tRNA-Gly
  130. Drosophila grimshawi tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 18)
  131. Drosophila guanche (Fruit fly) tRNA-Gly
  132. Drosophila gunungcola (Fruit fly) transfer RNA glycine (anticodon GCC)
  133. Drosophila hydei (Fruit fly) tRNA-Gly
  134. Drosophila innubila (Fruit fly) tRNA-Gly
  135. Drosophila kikkawai (Fruit fly) tRNA-Gly
  136. Drosophila mauritiana (Fruit fly) tRNA-Gly
  137. Drosophila melanogaster (fruit fly) transfer RNA:Glycine-GCC 1-11 (multiple genes)
  138. Drosophila miranda (Fruit fly) tRNA-Gly
  139. Drosophila mojavensis tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 13)
  140. Drosophila navojoa (Fruit fly) tRNA-Gly
  141. Drosophila obscura (Fruit fly) tRNA-Gly
  142. Drosophila persimilis tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 13)
  143. Drosophila pseudoobscura (Fruit fly) tRNA-Gly
  144. Drosophila pseudoobscura pseudoobscura tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 19)
  145. Drosophila rhopaloa (Fruit fly) tRNA-Gly
  146. Drosophila santomea (Fruit fly) tRNA-Gly
  147. Drosophila sechellia tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 12)
  148. Drosophila simulans tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 14)
  149. Drosophila subobscura (Fruit fly) tRNA-Gly
  150. Drosophila subpulchrella (Fruit fly) tRNA-Gly
  151. Drosophila suzukii (Fruit fly) tRNA-Gly
  152. Drosophila takahashii (Fruit fly) tRNA-Gly
  153. Drosophila teissieri (Fruit fly) tRNA-Gly
  154. Drosophila virilis tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 14)
  155. Drosophila willistoni tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 9)
  156. Drosophila yakuba tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 15)
  157. Dufourea novaeangliae (Bee) tRNA-Gly
  158. Erysiphe pulchra tRNA
  159. Eufriesea mexicana tRNA-Gly
  160. Eumeta japonica tRNA
  161. Exocentrus adspersus tRNA-OTHER
  162. Frankliniella occidentalis (western flower thrips) tRNA
  163. Frieseomelitta varia tRNA
  164. Galleria mellonella (Greater wax moth) tRNA-Gly
  165. Glossina austeni tRNA tRNA-Gly
  166. Glossina brevipalpis tRNA tRNA-Gly
  167. Glossina fuscipes fuscipes tRNA
  168. Glossina morsitans morsitans tRNA tRNA-Gly
  169. Glossina pallidipes tRNA tRNA-Gly
  170. Glossina palpalis gambiensis (Tsetse fly) tRNA tRNA-Gly
  171. Glyphotaelius pellucidus (Caddisflies) misc RNA ENSGPLG00000014738.1
  172. Gongylonema pulchrum tRNA
  173. Habropoda laboriosa tRNA-Gly
  174. Haemonchus contortus (barber pole worm) tRNA, Gly
  175. Haemonchus placei tRNA
  176. Halyomorpha halys (Brown marmorated stink bug) tRNA-Gly
  177. Harpegnathos saltator (Indian jumping ant) tRNA-Gly
  178. Heliconius melpomene (Postman butterfly) tRNA HMEL012697
  179. Helicoverpa armigera (Cotton bollworm) transfer RNA glycine (anticodon GCC)
  180. Helicoverpa zea tRNA-Gly
  181. Heligmosomoides polygyrus bakeri tRNA
  182. Heliothis virescens (tobacco budworm) tRNA
  183. Helobdella robusta tRNA-Gly for anticodon GCC
  184. Henosepilachna vigintioctopunctata tRNA-Gly
  185. Hermetia illucens tRNA-Gly
  186. Heterorhabditis bacteriophora tRNA
  187. Heterotrigona itama tRNA
  188. Homalodisca vitripennis tRNA-Gly
  189. Hylaeus anthracinus (Anthricinan yellow-faced bee) transfer RNA glycine (anticodon GCC)
  190. Hylaeus volcanicus (Volcano Masked Bee) transfer RNA glycine (anticodon GCC)
  191. Hypothenemus hampei tRNA-Gly
  192. Ichneumon xanthorius (Ichneumon Wasp) misc RNA ENSIXAG00005005793.1
  193. Ignelater luminosus (cucubano) tRNA
  194. Ladona fulva tRNA
  195. Lasius niger tRNA
  196. Leguminivora glycinivorella tRNA-Gly
  197. Leptidea sinapis tRNA
  198. Leptinotarsa decemlineata tRNA-Gly
  199. Limnephilus lunatus (Caddisflies) misc RNA ENSLLSG00015015296.1
  200. Limnephilus marmoratus (Caddisflies) misc RNA ENSLMMG00005016246.1
  201. Limnephilus rhombicus (Caddisflies) misc RNA ENSLRHG00005016238.1
  202. Limnoperna fortunei (Golden mussel) misc RNA ENSLFOG00000068754.1
  203. Limulus polyphemus tRNA-Gly
  204. Linepithema humile (Argentine ant) tRNA-Gly
  205. Lingula anatina (Lamp shell) tRNA-Gly
  206. Litomosoides sigmodontis tRNA
  207. Loa loa (Eye worm) tRNA-Gly for anticodon GCC
  208. Lucilia cuprina (Australian sheep blowfly) tRNA-Gly for anticodon GCC
  209. Lupinus angustifolius tRNA
  210. Lutzomyia longipalpis tRNA tRNA-Gly
  211. Machimus atricapillus (Kite-tailed Robberfly) misc RNA ENSAMHG00005011423.1
  212. Macrosteles quadrilineatus (Aster leafhopper) transfer RNA glycine (anticodon GCC)
  213. Macrostomum lignano tRNA
  214. Malaya genurostris (Mosquitos) transfer RNA glycine (anticodon GCC)
  215. Manduca sexta tRNA-Gly
  216. Megachile rotundata (Alfalfa leafcutting bee) tRNA-Gly
  217. Megaselia scalaris (Coffin fly) tRNA-Gly for anticodon GCC
  218. Melipona bicolor tRNA
  219. Melipona quadrifasciata tRNA
  220. Melitaea cinxia misc RNA ENSMCXG00005023346.1
  221. Mercenaria mercenaria (Hard clam (quahog)) tRNA-Gly
  222. Microctonus aethiopoides tRNA
  223. Molorchus minor tRNA-OTHER
  224. Monomorium pharaonis tRNA-Gly
  225. Musca domestica (House fly) tRNA MDOA012598
  226. Mya arenaria (Soft-shell clam) transfer RNA glycine (anticodon GCC)
  227. Myopa tessellatipennis (Thick-headed flies) misc RNA ENSMTEG00005012946.1
  228. Mytilus californianus (California mussel) transfer RNA glycine (anticodon GCC)
  229. Mytilus coruscus tRNA
  230. Mytilus edulis tRNA
  231. Mytilus galloprovincialis (Mediterranean mussel) tRNA
  232. Nasonia vitripennis tRNA-Gly
  233. Necator americanus tRNA
  234. Neodiprion lecontei tRNA-Gly
  235. Neodiprion pinetum tRNA-Gly
  236. Nephila pilipes tRNA
  237. Nesidiocoris tenuis tRNA
  238. Nezara viridula (southern green stink bug) tRNA
  239. Nippostrongylus brasiliensis tRNA
  240. Nylanderia fulva tRNA
  241. Octopus bimaculoides (California two-spot octopus) transfer RNA glycine (anticodon GCC)
  242. Octopus sinensis tRNA-Gly
  243. Octopus vulgaris (common octopus) tRNA
  244. Oesophagostomum dentatum tRNA
  245. Onchocerca flexuosa tRNA
  246. Onchocerca ochengi tRNA
  247. Onchocerca volvulus tRNA
  248. Ooceraea biroi tRNA-Gly
  249. Operophtera brumata (winter moth) tRNA
  250. Orussus abietinus (Parasitic wood wasp) tRNA-Gly
  251. Oryctes borbonicus tRNA
  252. Ostrea edulis (European flat oyster) transfer RNA glycine (anticodon GCC)
  253. Panagrolaimus sp. JU765 tRNA
  254. Papaver nudicaule tRNA
  255. Papaver somniferum (opium poppy) tRNA
  256. Papilio machaon tRNA
  257. Papilio xuthus tRNA
  258. Pararge aegeria aegeria tRNA
  259. Pararge aegeria tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 15)
  260. Arctia plantaginis Parasemia plantaginis tRNA
  261. Parasteatoda tepidariorum tRNA-Gly
  262. Parnassius apollo (apollo) tRNA
  263. Pectinophora gossypiella transfer RNA glycine (anticodon GCC)
  264. Pediculus humanus corporis tRNA tRNA-Gly
  265. Phaedon cochleariae (mustard beetle) tRNA
  266. Phaseolus vulgaris tRNA
  267. Phlebotomus argentipes (Sand fly) transfer RNA glycine (anticodon GCC)
  268. Phlebotomus papatasi tRNA tRNA-Gly
  269. Photinus pyralis (common eastern firefly) tRNA
  270. Phyllotreta striolata tRNA
  271. Pieris brassicae (large cabbage white) tRNA
  272. Pieris macdunnoughi tRNA
  273. Plectus sambesii tRNA
  274. Plodia interpunctella (Indianmeal moth) transfer RNA glycine (anticodon GCC)
  275. Plutella xylostella (diamondback moth) tRNA
  276. Pogonomyrmex barbatus tRNA-Gly
  277. Polistes canadensis (Red paper wasp) tRNA-Gly
  278. Polistes dominula tRNA-Gly
  279. Polistes fuscatus (Common paper wasp) tRNA-Gly
  280. Pollicipes pollicipes tRNA-Gly
  281. Polyplax serrata tRNA-Gly
  282. Potamilus streckersoni tRNA-Gly
  283. Priapulus caudatus tRNA-Gly
  284. Pristionchus pacificus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 24)
  285. Pseudoatta argentina tRNA
  286. Pseudomonadota bacterium tRNA-Gly
  287. Psylliodes chrysocephalus Psylliodes chrysocephala tRNA
  288. Puccinia striiformis f. sp. tritici PST-78 tRNA
  289. Punica granatum tRNA
  290. Rhagoletis pomonella tRNA-Gly
  291. Rhamnusium bicolor tRNA-OTHER
  292. Rhodnius prolixus (Kissing bug) tRNA tRNA-Gly
  293. Rhynchophorus ferrugineus (red palm weevil) tRNA
  294. Scaptodrosophila lebanonensis tRNA
  295. Schistocerca americana tRNA-Gly
  296. Schistocerca cancellata (South American locust) transfer RNA glycine (anticodon GCC)
  297. Schistocerca gregaria (Grasshoppers) transfer RNA glycine (anticodon GCC)
  298. Schistocerca nitens (Vagrant locust) transfer RNA glycine (anticodon GCC)
  299. Schistocerca piceifrons (Central American locust) tRNA-Gly
  300. Schistocerca serialis cubense (Grasshoppers) transfer RNA glycine (anticodon GCC)
  301. Acanthosepion pharaonis Sepia pharaonis tRNA
  302. Sergentomyia squamirostris tRNA-Gly
  303. Setaria digitata tRNA
  304. Sitophilus oryzae tRNA-Gly
  305. Solenopsis invicta (red fire ant) tRNA
  306. Spodoptera exigua (beet armyworm) tRNA
  307. Spodoptera frugiperda tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 16)
  308. Spodoptera littoralis tRNA
  309. Spodoptera litura tRNA
  310. Stegodyphus dumicola (Social spider) tRNA-Gly
  311. Stegodyphus mimosarum (African social velvet spider) tRNA-Gly for anticodon GCC
  312. Steinernema carpocapsae tRNA
  313. Steinernema glaseri tRNA
  314. Steinernema hermaphroditum tRNA
  315. Stomoxys calcitrans tRNA-Gly
  316. Strigamia maritima (Soil centipede) tRNA-Gly for anticodon GCC
  317. Strongylus vulgaris tRNA
  318. Handroanthus impetiginosus Tabebuia impetiginosa tRNA
  319. Teladorsagia circumcincta tRNA
  320. Temnothorax curvispinosus tRNA
  321. Temnothorax longispinosus tRNA
  322. Tenebrio molitor (yellow mealworm) tRNA
  323. Thelazia callipaeda tRNA
  324. Thrips palmi (Melon Thrips) tRNA-Gly
  325. Topomyia yanbarensis (Mosquitos) transfer RNA glycine (anticodon GCC)
  326. Toxorhynchites rutilus septentrionalis (Elephant mosquito) transfer RNA glycine (anticodon GCC)
  327. Trachymyrmex cornetzi tRNA
  328. Trachymyrmex septentrionalis tRNA
  329. Mycetomoellerius zeteki Trachymyrmex zeteki tRNA
  330. Tribolium castaneum tRNA-Gly for anticodon GCC
  331. Tribolium madens (Black flour beetle) tRNA-Gly
  332. Trichomalopsis sarcophagae tRNA
  333. Trichonephila clavata (joro spider) tRNA
  334. Trichonephila clavipes (golden silk orbweaver) tRNA
  335. Trichonephila inaurata madagascariensis tRNA
  336. Trichoplusia ni (cabbage looper) tRNA
  337. Trichostrongylus colubriformis tRNA-Gly
  338. Uloborus diversus (Orb Weaver) transfer RNA glycine (anticodon GCC)
  339. uncultured Gammaproteobacteria bacterium transfer RNA
  340. Uranotaenia lowii (Mosquitos) transfer RNA glycine (anticodon GCC)
  341. Vanessa tameamea tRNA
  342. Venturia canescens (Endoparasitoid wasp) tRNA-Gly
  343. Vespula germanica tRNA
  344. Vespula pensylvanica (western yellowjacket) tRNA
  345. Vespula vulgaris tRNA
  346. Wuchereria bancrofti tRNA-Gly
  347. Wyeomyia smithii (Pitcher plant Mosquito) transfer RNA glycine (anticodon GCC)
  348. Zerene cesonia tRNA-Gly
  349. Zeugodacus cucurbitae (Melon fly) transfer RNA glycine (anticodon GCC)
  350. Zootermopsis nevadensis tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 5)
  351. Zophobas morio tRNA
Relationships

Molecular Relationships

2D structure

Loading 2D structure...