Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Genome locations
Gene Ontology annotations
Loading ontology ancestors...
Failed to load QuickGO Ancestor chart
Sequence
Sequence features are shown above as colored rectangles.
Zoom in and click to view details, or
Reset
GCAUCGGUGGUUCAGUGGUAGAAUGCUCGCCUGCCACGCGGGCGGCCCGGGUUCGAUUCCCGGCCGAUGCA
Taxonomic tree
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree.
Click tree nodes to collapse or expand them.
Hover over taxon names to display additional information.
This sequence is found in 341 other species
Relationships
Molecular Relationships
2D structure
Download