Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila simulans tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 14) secondary structure diagram

Drosophila simulans tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 14) URS00003429B0_7240

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCAUCGGUGGUUCAGUGGUAGAAUGCUCGCCUGCCACGCGGGCGGCCCGGGUUCGAUUCCCGGCCGAUGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 220 other species

  1. Acanthoscelides obtectus hypothetical protein
  2. Acromyrmex echinatior tRNA-Gly
  3. Aedes aegypti (Yellow fever mosquito) tRNA AAEL018917
  4. Aedes albopictus tRNA tRNA-Gly
  5. Aethina tumida (Small hive beetle) transfer RNA glycine (anticodon GCC)
  6. Agrilus planipennis tRNA-Gly
  7. Amblyteles armatorius (Ichneumon Wasp) misc RNA ENSAAYG00000011479.1
  8. Amphibalanus amphitrite tRNA-Gly
  9. Amyelois transitella tRNA-Gly
  10. Ancistrocerus nigricornis (Potter wasp) misc RNA ENSANRG00000012438.1
  11. Ancylostoma caninum (dog hookworm) tRNA-Gly
  12. Ancylostoma ceylanicum tRNA
  13. Ancylostoma duodenale tRNA
  14. Anisakis simplex (herring worm) tRNA
  15. Anopheles albimanus tRNA
  16. Anopheles arabiensis (Mosquito) tRNA tRNA-Gly
  17. Anopheles atroparvus tRNA
  18. Anopheles christyi tRNA tRNA-Gly
  19. Anopheles coluzzii tRNA-Gly for anticodon GCC
  20. Anopheles culicifacies (Mosquito) tRNA tRNA-Gly
  21. Anopheles darlingi tRNA ADAC010736
  22. Anopheles dirus (Mosquito) tRNA tRNA-Gly
  23. Anopheles epiroticus (Mosquito) tRNA tRNA-Gly
  24. Anopheles farauti (Mosquito) tRNA tRNA-Gly
  25. Anopheles funestus tRNA-Gly for anticodon GCC
  26. Anopheles gambiae tRNA tRNA-Gly
  27. Anopheles gambiae str. PEST tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 16)
  28. Anopheles maculatus tRNA tRNA-Gly
  29. Anopheles melas (Mosquito) tRNA tRNA-Gly
  30. Anopheles merus tRNA tRNA-Gly
  31. Anopheles minimus tRNA tRNA-Gly
  32. Anopheles quadriannulatus (Mosquito) tRNA tRNA-Gly
  33. Anopheles sinensis tRNA tRNA-Gly
  34. Anopheles stephensi tRNA tRNA-Gly
  35. Anthonomus grandis grandis (Boll weevil) transfer RNA glycine (anticodon GCC)
  36. Apis dorsata tRNA-Gly
  37. Apis florea (Dwarf honeybee) tRNA-Gly
  38. Apis mellifera tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 6)
  39. Arabis alpina tRNA
  40. Araneus ventricosus tRNA-Gly
  41. Aromia moschata tRNA-OTHER
  42. Athalia rosae (Coleseed sawfly) misc RNA ENSAEAG00005006728.1
  43. Atta cephalotes tRNA LOC105616975-2
  44. Atta colombica tRNA
  45. Bactrocera dorsalis tRNA-Gly
  46. Bactrocera latifrons tRNA-Gly
  47. Bactrocera tryoni (Queensland fruitfly) tRNA-Gly
  48. Bicyclus anynana tRNA-Gly
  49. Blattella germanica tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 19)
  50. Bombus huntii (Hunt's bumblebee) transfer RNA glycine (anticodon GCC)
  51. Bombus terrestris tRNA LOC110119263
  52. Bombus vancouverensis nearcticus (Montane Bumble Bee) tRNA-Gly
  53. Bombyx mandarina (Wild silkworm) tRNA-Gly
  54. Bombyx mori tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 27)
  55. Brugia malayi tRNA
  56. Brugia pahangi tRNA
  57. Brugia timori tRNA
  58. Caerostris darwini tRNA-Gly
  59. Caerostris extrusa tRNA-Gly
  60. Callosobruchus analis hypothetical protein
  61. Callosobruchus chinensis (azuki bean weevil) hypothetical protein
  62. Camponotus floridanus tRNA-Gly
  63. Capitella teleta tRNA-Gly for anticodon GCC
  64. Cataglyphis hispanica (Desert ant) transfer RNA glycine (anticodon GCC)
  65. Centruroides sculpturatus tRNA-Gly
  66. Ceratitis capitata (Mediterranean fruit fly) tRNA-Gly
  67. Chelonus insularis tRNA-Gly
  68. Cimex lectularius tRNA-Gly
  69. Copidosoma floridanum tRNA-Gly
  70. Cordylochernes scorpioides tRNA-Gly
  71. Crassostrea angulata (Portuguese oyster) transfer RNA glycine (anticodon GCC)
  72. Crassostrea gigas tRNA-Gly for anticodon GCC
  73. Crassostrea virginica tRNA-Gly
  74. Cryptotermes secundus tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 4)
  75. Culex quinquefasciatus tRNA-Gly
  76. Cyphomyrmex costatus tRNA
  77. Danaus plexippus plexippus tRNA
  78. Diabrotica virgifera virgifera transfer RNA glycine (anticodon GCC)
  79. Dreissena polymorpha (Zebra mussle) transfer RNA glycine (anticodon GCC)
  80. Drosophila ananassae tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 15)
  81. Drosophila busckii tRNA
  82. Drosophila erecta tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 13)
  83. Drosophila ficusphila tRNA
  84. Drosophila grimshawi tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 18)
  85. Drosophila guanche tRNA.Gly
  86. Drosophila gunungcola tRNA-OTHER
  87. Drosophila melanogaster transfer RNA:Glycine-GCC 1-11 (multiple genes)
  88. Drosophila mojavensis tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 13)
  89. Drosophila persimilis tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 13)
  90. Drosophila pseudoobscura pseudoobscura tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 19)
  91. Drosophila sechellia tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 12)
  92. Drosophila virilis tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 14)
  93. Drosophila willistoni tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 9)
  94. Drosophila yakuba tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 15)
  95. Dufourea novaeangliae tRNA-Gly
  96. Eufriesea mexicana tRNA-Gly
  97. Eumeta japonica tRNA-Gly
  98. Exocentrus adspersus tRNA-OTHER
  99. Frieseomelitta varia (marmelada) tRNA-Gly
  100. Galleria mellonella tRNA-Gly
  101. Glossina austeni (Tsetse fly) tRNA tRNA-Gly
  102. Glossina brevipalpis (Tsetse fly) tRNA tRNA-Gly
  103. Glossina fuscipes fuscipes tRNA
  104. Glossina morsitans morsitans (Tsetse fly) tRNA tRNA-Gly
  105. Glossina pallidipes (Tsetse fly) tRNA tRNA-Gly
  106. Glossina palpalis gambiensis tRNA tRNA-Gly
  107. Glyphotaelius pellucidus (Caddisflies) misc RNA ENSGPLG00000014738.1
  108. Gongylonema pulchrum tRNA
  109. Habropoda laboriosa tRNA-Gly
  110. Haemonchus contortus tRNA
  111. Haemonchus placei tRNA
  112. Harpegnathos saltator tRNA-Gly
  113. Heliconius melpomene (Postman butterfly) tRNA HMEL012697
  114. Helicoverpa armigera transfer RNA glycine (anticodon GCC)
  115. Helicoverpa zea (Corn earworm) tRNA-Gly
  116. Heligmosomoides bakeri tRNA
  117. Helobdella robusta tRNA-Gly for anticodon GCC
  118. Hermetia illucens tRNA-Gly
  119. Heterorhabditis bacteriophora tRNA
  120. Homalodisca vitripennis (Glassy winged sharpshooter) tRNA-Gly
  121. Ichneumon xanthorius (Ichneumon Wasp) misc RNA ENSIXAG00005005793.1
  122. Lasius niger tRNA
  123. Leguminivora glycinivorella tRNA-Gly
  124. Leptinotarsa decemlineata (Colorado potato beetle) tRNA-Gly
  125. Limnephilus lunatus (Caddisflies) misc RNA ENSLLSG00015015296.1
  126. Limnephilus marmoratus (Caddisflies) misc RNA ENSLMMG00005016246.1
  127. Limnephilus rhombicus (Caddisflies) misc RNA ENSLRHG00005016238.1
  128. Limnoperna fortunei (Golden mussle) misc RNA ENSLFOG00000068754.1
  129. Limulus polyphemus (Atlantic horseshoe crab) tRNA-Gly
  130. Linepithema humile (Argentine ant) tRNA-Gly
  131. Lingula anatina (Lamp shell) tRNA-Gly
  132. Loa loa tRNA-Gly for anticodon GCC
  133. Lucilia cuprina tRNA-Gly for anticodon GCC
  134. Lupinus angustifolius (narrow-leaved blue lupine) tRNA
  135. Lutzomyia longipalpis tRNA tRNA-Gly
  136. Macrosteles quadrilineatus (Aster leafhopper) transfer RNA glycine (anticodon GCC)
  137. Macrostomum lignano tRNA
  138. Manduca sexta tRNA-Gly
  139. Megachile rotundata (Alfalfa leafcutting bee) tRNA-Gly
  140. Megaselia scalaris (Coffin fly) tRNA-Gly for anticodon GCC
  141. Melipona bicolor tRNA-Gly
  142. Melipona quadrifasciata tRNA
  143. Melitaea cinxia (Glanville fritillary) misc RNA ENSMCXG00005023346.1
  144. Mercenaria mercenaria (Hard clam (quahog)) tRNA-Gly
  145. Molorchus minor tRNA-OTHER
  146. Monomorium pharaonis tRNA-Gly
  147. Musca domestica (House fly) tRNA MDOA012598
  148. Mya arenaria (Soft-shell clam) transfer RNA glycine (anticodon GCC)
  149. Mytilus galloprovincialis tRNA
  150. Nasonia vitripennis tRNA-Gly
  151. Necator americanus tRNA
  152. Neodiprion lecontei tRNA-Gly
  153. Neodiprion pinetum (White pine sawfly) tRNA-Gly
  154. Nephila pilipes tRNA-Gly
  155. Nippostrongylus brasiliensis tRNA
  156. Octopus bimaculoides (Octopus) tRNA-Gly
  157. Octopus sinensis (East Asian common octopus) tRNA-Gly
  158. Oesophagostomum dentatum tRNA
  159. Onchocerca flexuosa tRNA-Gly
  160. Onchocerca ochengi tRNA
  161. Onchocerca volvulus tRNA
  162. Ooceraea biroi tRNA-Gly
  163. Operophtera brumata (winter moth) tRNA
  164. Orussus abietinus tRNA-Gly
  165. Oryctes borbonicus tRNA
  166. Ostrea edulis (European flat oyster) transfer RNA glycine (anticodon GCC)
  167. Papilio machaon tRNA
  168. Papilio xuthus tRNA
  169. Pararge aegeria tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 15)
  170. Parasteatoda tepidariorum tRNA-Gly
  171. Pectinophora gossypiella transfer RNA glycine (anticodon GCC)
  172. Pediculus humanus corporis tRNA tRNA-Gly
  173. Phaseolus vulgaris tRNA
  174. Phlebotomus papatasi tRNA tRNA-Gly
  175. Plutella xylostella (diamondback moth) tRNA-Gly
  176. Pogonomyrmex barbatus tRNA-Gly
  177. Polistes canadensis tRNA-Gly
  178. Polistes dominula (European paper wasp) tRNA-Gly
  179. Polistes fuscatus (Common paper wasp) tRNA-Gly
  180. Pollicipes pollicipes tRNA-Gly
  181. Potamilus streckersoni tRNA-Gly
  182. Priapulus caudatus tRNA-Gly
  183. Pristionchus pacificus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 24)
  184. Pseudomonadota bacterium tRNA-Gly
  185. Puccinia striiformis f. sp. tritici PST-78 tRNA
  186. Punica granatum tRNA
  187. Rhagoletis pomonella tRNA-Gly
  188. Rhamnusium bicolor tRNA-OTHER
  189. Rhodnius prolixus tRNA tRNA-Gly
  190. Schistocerca americana tRNA-Gly
  191. Schistocerca cancellata (South American locust) transfer RNA glycine (anticodon GCC)
  192. Schistocerca gregaria (Grasshoppers) transfer RNA glycine (anticodon GCC)
  193. Schistocerca nitens (Vagrant locust) transfer RNA glycine (anticodon GCC)
  194. Schistocerca piceifrons (Central American locust) tRNA-Gly
  195. Schistocerca serialis cubense (Grasshoppers) transfer RNA glycine (anticodon GCC)
  196. Sitophilus oryzae (Rice weevil) tRNA-Gly
  197. Solenopsis invicta tRNA
  198. Spodoptera frugiperda tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 16)
  199. Stegodyphus dumicola tRNA-Gly
  200. Stegodyphus mimosarum (African social velvet spider) tRNA-Gly for anticodon GCC
  201. Steinernema glaseri tRNA
  202. Stomoxys calcitrans tRNA-Gly
  203. Strigamia maritima tRNA-Gly for anticodon GCC
  204. Teladorsagia circumcincta tRNA-Gly
  205. Thelazia callipaeda tRNA
  206. Thrips palmi (Melon Thrips) tRNA-Gly
  207. Trachymyrmex cornetzi tRNA
  208. Trachymyrmex septentrionalis tRNA
  209. Trachymyrmex zeteki tRNA
  210. Tribolium castaneum tRNA-Gly for anticodon GCC
  211. Trichomalopsis sarcophagae tRNA
  212. Trichonephila clavata tRNA-Gly
  213. Trichonephila clavipes tRNA-Gly
  214. Trichonephila inaurata madagascariensis (Nephila madagascariensis) tRNA-Gly
  215. Trichostrongylus colubriformis tRNA-Gly
  216. uncultured Gammaproteobacteria bacterium transfer RNA
  217. Venturia canescens tRNA-Gly
  218. Wuchereria bancrofti tRNA
  219. Zerene cesonia tRNA-Gly
  220. Zootermopsis nevadensis tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 5)
2D structure Publications