Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Neodiprion lecontei (Redheaded pine sawfly) tRNA-Gly secondary structure diagram

Neodiprion lecontei (Redheaded pine sawfly) tRNA-Gly URS00003429B0_441921

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCAUCGGUGGUUCAGUGGUAGAAUGCUCGCCUGCCACGCGGGCGGCCCGGGUUCGAUUCCCGGCCGAUGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 367 other species

  1. Acanthocheilonema viteae tRNA
  2. Acanthoscelides obtectus tRNA
  3. Acrobeloides nanus tRNA
  4. Acromyrmex charruanus tRNA
  5. Acromyrmex echinatior (Panamanian leaf-cutter ant) tRNA-Gly
  6. Acromyrmex heyeri tRNA
  7. Aedes aegypti tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 39)
  8. Aedes albopictus tRNA tRNA-Gly
  9. Aethina tumida (Small hive beetle) transfer RNA glycine (anticodon GCC)
  10. Agrilus planipennis (Emerald ash borer) tRNA-Gly
  11. Amblyteles armatorius (Ichneumon Wasp) misc RNA ENSAAYG00000011479.1
  12. Amphibalanus amphitrite (Acorn barnacle) tRNA-Gly
  13. Amyelois transitella (Moths) transfer RNA glycine (anticodon GCC)
  14. Anastrepha ludens (Mexican fruit fly) transfer RNA glycine (anticodon GCC)
  15. Anastrepha obliqua (WestIndian fruit fly) transfer RNA glycine (anticodon GCC)
  16. Ancistrocerus nigricornis (Potter wasp) misc RNA ENSANRG00000012438.1
  17. Ancylostoma caninum (dog hookworm) tRNA
  18. Ancylostoma ceylanicum tRNA
  19. Ancylostoma duodenale tRNA
  20. Anisakis simplex (herring worm) tRNA
  21. Anopheles albimanus (Mosquitos) tRNA-Gly
  22. Anopheles arabiensis tRNA tRNA-Gly
  23. Anopheles atroparvus tRNA
  24. Anopheles christyi tRNA tRNA-Gly
  25. Anopheles coluzzii tRNA-Gly for anticodon GCC
  26. Anopheles culicifacies tRNA tRNA-Gly
  27. Anopheles darlingi tRNA ADAC010736
  28. Anopheles dirus tRNA tRNA-Gly
  29. Anopheles epiroticus tRNA tRNA-Gly
  30. Anopheles farauti tRNA tRNA-Gly
  31. Anopheles funestus (African malaria mosquito) tRNA-Gly for anticodon GCC
  32. Anopheles gambiae tRNA tRNA-Gly
  33. Anopheles gambiae str. PEST tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 16)
  34. Anopheles maculatus tRNA tRNA-Gly
  35. Anopheles melas tRNA tRNA-Gly
  36. Anopheles merus tRNA tRNA-Gly
  37. Anopheles minimus (Mosquito) tRNA tRNA-Gly
  38. Anopheles quadriannulatus tRNA tRNA-Gly
  39. Anopheles sinensis tRNA tRNA-Gly
  40. Anopheles stephensi (Asian malaria mosquito) tRNA tRNA-Gly
  41. Anoplophora glabripennis (Asian long-horned beetle) tRNA-Gly
  42. Anthonomus grandis grandis transfer RNA glycine (anticodon GCC)
  43. Aphelenchoides avenae Aphelenchus avenae tRNA-Gly
  44. Apis cerana cerana tRNA
  45. Apis dorsata (Giant honeybee) tRNA-Gly
  46. Apis florea (Dwarf honeybee) tRNA-Gly
  47. Apis mellifera tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 6)
  48. Apolygus lucorum tRNA
  49. Arabis alpina (gray rockcress) tRNA
  50. Araneus ventricosus tRNA
  51. Argiope bruennichi (Wasp spider) transfer RNA glycine (anticodon GCC)
  52. Aromia moschata tRNA-OTHER
  53. Asbolus verrucosus (desert ironclad beetle) tRNA
  54. Athalia rosae misc RNA ENSAEAG00005006728.1
  55. Atta cephalotes tRNA LOC105616975-2
  56. Atta colombica tRNA
  57. Bactrocera dorsalis transfer RNA glycine (anticodon GCC)
  58. Bactrocera latifrons (Solanum fruit fly) tRNA-Gly
  59. Bactrocera neohumeralis (Lesser Queensland fruit fly) transfer RNA glycine (anticodon GCC)
  60. Bactrocera oleae (Olive fruit fly) tRNA-Gly
  61. Bactrocera tryoni tRNA-Gly
  62. Bicyclus anynana (squinting bush brown) misc RNA ENSINYG00000026587.1
  63. Blattella germanica tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 19)
  64. Bombus affinis (Rusty patched bumble bee) transfer RNA glycine (anticodon GCC)
  65. Bombus huntii (Hunt's bumblebee) transfer RNA glycine (anticodon GCC)
  66. Bombus impatiens (Common eastern bumblebee) tRNA-Gly
  67. Bombus terrestris misc RNA ENSBTSG00005024623.1
  68. Bombus vancouverensis nearcticus (Montane Bumble Bee) tRNA-Gly
  69. Bombus vosnesenskii tRNA
  70. Bombyx mandarina tRNA-Gly
  71. Bombyx mori tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 27)
  72. Bradysia coprophila (Black fungus gnats) tRNA-Gly
  73. Pseudolycoriella hygida Bradysia hygida tRNA
  74. Brassicogethes aeneus (rape pollen beetle) tRNA
  75. Brenthis ino (lesser marbled fritillary) tRNA
  76. Brugia malayi (Nematode) tRNA Bm14580
  77. Brugia pahangi tRNA
  78. Brugia timori tRNA
  79. Caenorhabditis auriculariae tRNA
  80. Caenorhabditis sp. 36 PRJEB53466 tRNA
  81. Caerostris darwini tRNA-Gly
  82. Caerostris extrusa tRNA-Gly
  83. Callosobruchus analis hypothetical protein
  84. Callosobruchus chinensis hypothetical protein
  85. Callosobruchus maculatus (cowpea weevil) tRNA
  86. Camponotus floridanus (Florida carpenter ant) tRNA-Gly
  87. Candidatus Nitrosopumilus sp. tRNA-Gly
  88. Capitella teleta tRNA-Gly for anticodon GCC
  89. Cataglyphis hispanica (Desert ant) transfer RNA glycine (anticodon GCC)
  90. Centruroides sculpturatus tRNA-Gly
  91. Cephus cinctus (wheat stem sawfly) tRNA
  92. Ceratitis capitata tRNA-Gly
  93. Cercopithifilaria johnstoni tRNA
  94. Ceutorhynchus assimilis (cabbage seed weevil) tRNA
  95. Chelonus insularis (Parasitoid wasp) tRNA-Gly
  96. Chrysodeixis includens tRNA
  97. Cimex lectularius (Bed bug) tRNA-Gly
  98. Cloeon dipterum tRNA
  99. Copidosoma floridanum (Parasitoid wasp) tRNA-Gly
  100. Coptotermes formosanus (Formosan subterranean termite) tRNA
  101. Cordylochernes scorpioides tRNA-Gly
  102. Coremacera marginata (Sieve-winged Snailkiller) misc RNA ENSCNRG00005015268.1
  103. Magallana angulata Crassostrea angulata (Portuguese oyster) transfer RNA glycine (anticodon GCC)
  104. Magallana angulata Crassostrea angulata (Portuguese oyster) transfer RNA glycine (anticodon GCC)
  105. Crassostrea virginica tRNA-Gly
  106. Cryptolaemus montrouzieri tRNA-Gly
  107. Cryptotermes secundus tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 4)
  108. Ctenocephalides felis (Cat flea) tRNA-Gly
  109. Culex pipiens pallens (Northern house mosquito) transfer RNA glycine (anticodon GCC)
  110. Culex quinquefasciatus tRNA
  111. Cyanobacteria bacterium J06638_20 tRNA-Gly
  112. Cydia pomonella (The codling moth) transfer RNA glycine (anticodon GCC)
  113. Cylas formicarius (Sweet potato weevil) transfer RNA glycine (anticodon GCC)
  114. Cylicocyclus nassatus tRNA
  115. Cyphomyrmex costatus tRNA
  116. Danaus chrysippus (African queen) tRNA
  117. Danaus plexippus (monarch butterfly) misc RNA ENSDPXG00000018629.1
  118. Danaus plexippus plexippus (Monarch butterfly) tRNA-Gly
  119. Darwinula stevensoni tRNA
  120. Diabrotica balteata tRNA
  121. Diabrotica virgifera virgifera transfer RNA glycine (anticodon GCC)
  122. Diatraea saccharalis (sugarcane borer) tRNA
  123. Dicrurus megarhynchus tRNA
  124. Dinoponera quadriceps (south american ant) tRNA
  125. Diorhabda carinulata (Northern tamarisk beetle) transfer RNA glycine (anticodon GCC)
  126. Diorhabda sublineata (Subtropical tamarisk beetle) transfer RNA glycine (anticodon GCC)
  127. Dirofilaria immitis tRNA-Gly
  128. Dolichomitus sp. PSUC_FEM 10030005 tRNA
  129. Dreissena polymorpha (Zebra mussel) transfer RNA glycine (anticodon GCC)
  130. Drosophila albomicans (Fruit fly) transfer RNA glycine (anticodon GCC)
  131. Drosophila ananassae tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 15)
  132. Drosophila arizonae (Fruit fly) tRNA-Gly
  133. Drosophila biarmipes (Fruit fly) transfer RNA glycine (anticodon GCC)
  134. Drosophila bipectinata (Pomace flies) transfer RNA glycine (anticodon GCC)
  135. Drosophila busckii (Fruit fly) tRNA-Gly
  136. Drosophila elegans (Pomace flies) tRNA-Gly
  137. Drosophila erecta tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 13)
  138. Drosophila eugracilis (Fruit fly) tRNA-Gly
  139. Drosophila ficusphila (Fruit fly) tRNA-Gly
  140. Drosophila grimshawi tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 18)
  141. Drosophila guanche (Fruit fly) tRNA-Gly
  142. Drosophila gunungcola (Fruit fly) transfer RNA glycine (anticodon GCC)
  143. Drosophila hydei (Fruit fly) tRNA-Gly
  144. Drosophila innubila (Fruit fly) tRNA-Gly
  145. Drosophila kikkawai (Pomace flies) transfer RNA glycine (anticodon GCC)
  146. Drosophila mauritiana (Fruit fly) tRNA-Gly
  147. Drosophila melanogaster transfer RNA:Glycine-GCC 1-11 (multiple genes)
  148. Drosophila miranda (Fruit fly) tRNA-Gly
  149. Drosophila mojavensis tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 13)
  150. Drosophila montana (Pomace flies) transfer RNA glycine (anticodon GCC)
  151. Drosophila nasuta (Pomace flies) transfer RNA glycine (anticodon GCC)
  152. Drosophila navojoa (Fruit fly) tRNA-Gly
  153. Drosophila novamexicana (Pomace flies) tRNA-Gly
  154. Drosophila obscura (Fruit fly) tRNA-Gly
  155. Drosophila persimilis tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 13)
  156. Drosophila pseudoobscura (Fruit fly) tRNA-Gly
  157. Drosophila pseudoobscura pseudoobscura tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 19)
  158. Drosophila rhopaloa (Fruit fly) tRNA-Gly
  159. Drosophila santomea (Fruit fly) tRNA-Gly
  160. Drosophila sechellia tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 12)
  161. Drosophila serrata (Pomace flies) tRNA-Gly
  162. Drosophila simulans tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 14)
  163. Drosophila subobscura (Fruit fly) tRNA-Gly
  164. Drosophila subpulchrella (Fruit fly) tRNA-Gly
  165. Drosophila sulfurigaster albostrigata (Flies) transfer RNA glycine (anticodon GCC)
  166. Drosophila suzukii (Pomace flies) transfer RNA glycine (anticodon GCC)
  167. Drosophila takahashii (Pomace flies) transfer RNA glycine (anticodon GCC)
  168. Drosophila teissieri (Fruit fly) tRNA-Gly
  169. Drosophila tropicalis (Pomace flies) transfer RNA glycine (anticodon GCC)
  170. Drosophila virilis tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 14)
  171. Drosophila willistoni tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 9)
  172. Drosophila yakuba tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 15)
  173. Dufourea novaeangliae (Bee) tRNA-Gly
  174. Erysiphe pulchra tRNA
  175. Eufriesea mexicana (Mexican orchid bee) tRNA-Gly
  176. Eumeta japonica tRNA
  177. Exocentrus adspersus tRNA-OTHER
  178. Frankliniella occidentalis (western flower thrips) tRNA
  179. Frieseomelitta varia tRNA
  180. Galleria mellonella (greater wax moth) tRNA
  181. Gammaproteobacteria bacterium tRNA-Gly
  182. Glossina austeni tRNA tRNA-Gly
  183. Glossina brevipalpis (Tsetse fly) tRNA tRNA-Gly
  184. Glossina fuscipes fuscipes tRNA
  185. Glossina fuscipes (Tsetse fly) tRNA-Gly
  186. Glossina morsitans morsitans (Tsetse fly) tRNA tRNA-Gly
  187. Glossina pallidipes (Tsetse fly) tRNA tRNA-Gly
  188. Glossina palpalis gambiensis (Tsetse fly) tRNA tRNA-Gly
  189. Glyphotaelius pellucidus (Caddisflies) misc RNA ENSGPLG00000014738.1
  190. Gongylonema pulchrum tRNA
  191. Habropoda laboriosa (Southeastern blueberry bee) tRNA-Gly
  192. Haemonchus contortus tRNA, Gly
  193. Haemonchus placei tRNA
  194. Halyomorpha halys (Brown marmorated stink bug) tRNA-Gly
  195. Harpegnathos saltator (Indian jumping ant) tRNA-Gly
  196. Heliconius melpomene (Postman butterfly) tRNA HMEL012697
  197. Helicoverpa armigera (Cotton bollworm) transfer RNA glycine (anticodon GCC)
  198. Helicoverpa zea tRNA-Gly
  199. Heligmosomoides polygyrus bakeri tRNA
  200. Heliothis virescens (tobacco budworm) tRNA
  201. Helobdella robusta tRNA-Gly for anticodon GCC
  202. Henosepilachna vigintioctopunctata tRNA-Gly
  203. Hermetia illucens tRNA-Gly
  204. Heterorhabditis bacteriophora tRNA
  205. Heterotrigona itama tRNA
  206. Homalodisca vitripennis tRNA-Gly
  207. Hylaeus anthracinus (Anthricinan yellow-faced bee) transfer RNA glycine (anticodon GCC)
  208. Hylaeus volcanicus (Volcano Masked Bee) transfer RNA glycine (anticodon GCC)
  209. Hypothenemus hampei tRNA-Gly
  210. Ichneumon xanthorius (Ichneumon Wasp) misc RNA ENSIXAG00005005793.1
  211. Ignelater luminosus (cucubano) tRNA
  212. Ischnura elegans (Damselflies) tRNA-Gly
  213. Ladona fulva tRNA
  214. Lasius niger tRNA
  215. Leguminivora glycinivorella tRNA-Gly
  216. Leptidea sinapis tRNA
  217. Leptinotarsa decemlineata (Colorado potato beetle) tRNA-Gly
  218. Limnephilus lunatus (Caddisflies) misc RNA ENSLLSG00015015296.1
  219. Limnephilus marmoratus (Caddisflies) misc RNA ENSLMMG00005016246.1
  220. Limnephilus rhombicus (Caddisflies) misc RNA ENSLRHG00005016238.1
  221. Limnoperna fortunei (Golden mussel) misc RNA ENSLFOG00000068754.1
  222. Limulus polyphemus tRNA-Gly
  223. Lindaspio polybranchiata transfer RNA
  224. Linepithema humile (Argentine ant) transfer RNA glycine (anticodon GCC)
  225. Lingula anatina tRNA-Gly
  226. Litomosoides sigmodontis tRNA
  227. Loa loa tRNA-Gly for anticodon GCC
  228. Lucilia cuprina tRNA-Gly for anticodon GCC
  229. Lucilia sericata (Common green bottle fly) tRNA-Gly
  230. Lupinus angustifolius tRNA
  231. Lutzomyia longipalpis tRNA tRNA-Gly
  232. Machimus atricapillus (Kite-tailed Robberfly) misc RNA ENSAMHG00005011423.1
  233. Macrosteles quadrilineatus (Aster leafhopper) transfer RNA glycine (anticodon GCC)
  234. Macrostomum lignano tRNA
  235. Magallana gigas (Pacific oyster) transfer RNA glycine (anticodon GCC)
  236. Malaya genurostris (Mosquitos) transfer RNA glycine (anticodon GCC)
  237. Manduca sexta tRNA-Gly
  238. Megachile rotundata (Alfalfa leafcutting bee) tRNA-Gly
  239. Megaselia scalaris (Coffin fly) tRNA-Gly for anticodon GCC
  240. Melipona bicolor tRNA
  241. Melipona quadrifasciata tRNA
  242. Melitaea cinxia misc RNA ENSMCXG00005023346.1
  243. Mercenaria mercenaria (Northern quahog) transfer RNA glycine (anticodon GCC)
  244. Microctonus aethiopoides tRNA
  245. Molorchus minor tRNA-OTHER
  246. Monomorium pharaonis (Pharaoh ant) tRNA-Gly
  247. Musca domestica (House fly) transfer RNA glycine (anticodon GCC)
  248. Mya arenaria (Soft-shell clam) transfer RNA glycine (anticodon GCC)
  249. Myopa tessellatipennis (flies) misc RNA ENSMTEG00005013486.1
  250. Mytilus californianus (California mussel) transfer RNA glycine (anticodon GCC)
  251. Mytilus coruscus tRNA
  252. Mytilus edulis tRNA
  253. Mytilus galloprovincialis tRNA
  254. Nasonia vitripennis (Jewel wasp) tRNA-Gly
  255. Necator americanus tRNA
  256. Neodiprion pinetum (White pine sawfly) tRNA-Gly
  257. Nephila pilipes tRNA
  258. Nesidiocoris tenuis tRNA
  259. Nezara viridula (southern green stink bug) tRNA
  260. Nippostrongylus brasiliensis tRNA
  261. Nylanderia fulva tRNA
  262. Octopus bimaculoides (California two-spot octopus) transfer RNA glycine (anticodon GCC)
  263. Octopus sinensis tRNA-Gly
  264. Octopus vulgaris (common octopus) tRNA
  265. Oesophagostomum dentatum tRNA
  266. Onchocerca flexuosa tRNA
  267. Onchocerca ochengi tRNA
  268. Onchocerca volvulus (Nematode) tRNA OVOC13063
  269. Ooceraea biroi tRNA-Gly
  270. Operophtera brumata tRNA
  271. Orussus abietinus tRNA-Gly
  272. Oryctes borbonicus tRNA
  273. Ostrea edulis (Mud oyster) transfer RNA glycine (anticodon GCC)
  274. Panagrolaimus sp. JU765 tRNA
  275. Papaver nudicaule tRNA
  276. Papaver somniferum (opium poppy) tRNA
  277. Papilio machaon tRNA
  278. Papilio xuthus tRNA
  279. Pararge aegeria aegeria tRNA
  280. Pararge aegeria tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 15)
  281. Arctia plantaginis Parasemia plantaginis tRNA
  282. Parasteatoda tepidariorum tRNA-Gly
  283. Parnassius apollo (apollo) tRNA
  284. Pectinophora gossypiella (Pink bollworm) transfer RNA glycine (anticodon GCC)
  285. Pediculus humanus corporis tRNA tRNA-Gly
  286. Phaedon cochleariae (mustard beetle) tRNA
  287. Phaseolus vulgaris tRNA
  288. Phlebotomus argentipes (Sand fly) transfer RNA glycine (anticodon GCC)
  289. Phlebotomus papatasi tRNA tRNA-Gly
  290. Photinus pyralis (Common eastern firefly) tRNA-Gly
  291. Phthorimaea operculella tRNA-Gly
  292. Phyllotreta striolata tRNA
  293. Pieris brassicae (large cabbage white) tRNA
  294. Pieris macdunnoughi tRNA
  295. Plectus sambesii tRNA
  296. Plodia interpunctella (Indianmeal moth) transfer RNA glycine (anticodon GCC)
  297. Plutella xylostella tRNA
  298. Pogonomyrmex barbatus (Red harvester ant) tRNA-Gly
  299. Pogonomyrmex californicus tRNA-Gly
  300. Polistes canadensis (Red paper wasp) tRNA-Gly
  301. Polistes dominula (European paper wasp) tRNA-Gly
  302. Polistes fuscatus tRNA-Gly
  303. Pollicipes pollicipes tRNA-Gly
  304. Polyplax serrata tRNA-Gly
  305. Potamilus streckersoni tRNA-Gly
  306. Priapulus caudatus tRNA-Gly
  307. Pristionchus pacificus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 24)
  308. Pseudoatta argentina tRNA
  309. Pseudomonadota bacterium tRNA-Gly
  310. Psylliodes chrysocephalus Psylliodes chrysocephala tRNA
  311. Puccinia striiformis f. sp. tritici PST-78 tRNA
  312. Punica granatum tRNA
  313. Pycnogonum litorale transfer RNA
  314. Rhagoletis pomonella tRNA-Gly
  315. Rhamnusium bicolor tRNA-OTHER
  316. Rhodnius prolixus tRNA tRNA-Gly
  317. Rhynchophorus ferrugineus (red palm weevil) tRNA
  318. Scaptodrosophila lebanonensis tRNA
  319. Schistocerca americana (American grasshopper) tRNA-Gly
  320. Schistocerca cancellata (South American locust) transfer RNA glycine (anticodon GCC)
  321. Schistocerca gregaria (Grasshoppers) transfer RNA glycine (anticodon GCC)
  322. Schistocerca nitens (Vagrant locust) transfer RNA glycine (anticodon GCC)
  323. Schistocerca piceifrons (Central American locust) tRNA-Gly
  324. Schistocerca serialis cubense (Grasshoppers) transfer RNA glycine (anticodon GCC)
  325. Acanthosepion pharaonis Sepia pharaonis tRNA
  326. Sergentomyia squamirostris tRNA-Gly
  327. Setaria digitata tRNA
  328. Sitophilus oryzae tRNA-Gly
  329. Solenopsis invicta (Red fire ant) tRNA-Gly
  330. Spodoptera exigua (beet armyworm) tRNA
  331. Spodoptera frugiperda tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 16)
  332. Spodoptera littoralis tRNA
  333. Spodoptera litura tRNA
  334. Stegodyphus dumicola (Social spider) tRNA-Gly
  335. Stegodyphus mimosarum tRNA-Gly for anticodon GCC
  336. Steinernema carpocapsae tRNA
  337. Steinernema glaseri tRNA
  338. Steinernema hermaphroditum tRNA
  339. Stomoxys calcitrans (stable fly) transfer RNA glycine (anticodon GCC)
  340. Strigamia maritima tRNA-Gly for anticodon GCC
  341. Strongylus vulgaris tRNA
  342. Handroanthus impetiginosus Tabebuia impetiginosa tRNA
  343. Teladorsagia circumcincta tRNA
  344. Teleopsis dalmanni (Malaysian stalk-eyed fly) tRNA-Gly
  345. Temnothorax curvispinosus tRNA
  346. Temnothorax longispinosus tRNA
  347. Tenebrio molitor (yellow mealworm) tRNA
  348. Thelazia callipaeda tRNA
  349. Thrips palmi tRNA-Gly
  350. Topomyia yanbarensis (Mosquitos) transfer RNA glycine (anticodon GCC)
  351. Toxorhynchites rutilus septentrionalis (Elephant mosquito) transfer RNA glycine (anticodon GCC)
  352. Trachymyrmex cornetzi tRNA
  353. Trachymyrmex septentrionalis tRNA
  354. Mycetomoellerius zeteki Trachymyrmex zeteki tRNA
  355. Tribolium castaneum transfer RNA glycine (anticodon GCC)
  356. Tribolium madens (Black flour beetle) tRNA-Gly
  357. Trichomalopsis sarcophagae tRNA
  358. Trichonephila clavata (joro spider) tRNA
  359. Trichonephila clavipes (golden silk orbweaver) tRNA
  360. Trichonephila inaurata madagascariensis tRNA
  361. Trichoplusia ni (cabbage looper) tRNA
  362. Trichostrongylus colubriformis tRNA-Gly
  363. Uloborus diversus (Orb Weaver) transfer RNA glycine (anticodon GCC)
  364. uncultured Gammaproteobacteria bacterium transfer RNA
  365. Uranotaenia lowii (Mosquitos) transfer RNA glycine (anticodon GCC)
  366. Vanessa tameamea tRNA
  367. Venturia canescens (Endoparasitoid wasp) tRNA-Gly
  368. Vespa mandarinia (Asian giant hornet) tRNA-Gly
  369. Vespula germanica tRNA
  370. Vespula pensylvanica (western yellowjacket) tRNA
  371. Vespula vulgaris tRNA
  372. Wuchereria bancrofti tRNA-Gly
  373. Wyeomyia smithii (Pitcher plant Mosquito) transfer RNA glycine (anticodon GCC)
  374. Zerene cesonia (Southern Dogface) tRNA-Gly
  375. Zeugodacus cucurbitae (Melon fly) transfer RNA glycine (anticodon GCC)
  376. Zootermopsis nevadensis tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 5)
  377. Zophobas morio tRNA
Relationships

Molecular Relationships

2D structure

Loading 2D structure...