Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Equus caballus (horse) eca-miR-215 URS0000315B13_9796

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

eca-mir-215: Eca-mir-215 is a miRNA that has been identified as a statistically significant differentially expressed miRNA (DEmiR) in multiple studies. Using DESeq2, 11 DEmiRs were identified, including eca-mir-215, in a study that accounted for the level of hemolysis [PMC5748701]. Eight of these DEmiRs were also reported by edgeR [PMC5748701]. In an equine model of severe asthma, eca-mir-215 was found to be differentially expressed in serum and was shown to regulate airway remodeling and CD4+ T cell maturation and differentiation [PMC8372030]. Eca-mir-215 was also identified as a DEmiR in plasma and synovial fluid (SF)-derived extracellular vesicles (EVs) in the context of osteochondral injury [PMC9393553]. Additionally, eca-mir-215 was found to be differentially expressed in plasma and SF when comparing control samples to osteoarthritis samples or samples at different time points [PMC9393553]. Eca-mir-215 was also identified as a DEmiR in pairwise comparisons between control and osteoarthritis samples [PMC9393553]. Overall, these studies highlight the potential role of eca-mir-215 in various biological processes and its relevance as a potential biomarker or therapeutic target.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUGACCUAUGAAUUGACAGAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Alligator mississippiensis (American alligator) ami-miR-215-5p
  2. Capra hircus chi-miR-215-5p
  3. Chrysemys picta bellii Cpi-Mir-192-P1_5p (mature (guide))
  4. Chrysemys picta cpi-miR-215-5p
  5. Gallus gallus gga-miR-215-5p
  6. Gorilla gorilla gorilla ggo-miR-215 (MIR215)
  7. Gorilla gorilla (western gorilla) ggo-miR-215
  8. Homo sapiens (human) hsa-miR-215-5p
  9. Macaca mulatta (Rhesus monkey) mml-miR-215-5p
  10. Macaca nemestrina (pig-tailed macaque) mne-miR-215
  11. Ornithorhynchus anatinus (platypus) oan-miR-215-5p
  12. Pan troglodytes ptr-miR-215
  13. Pongo pygmaeus ppy-miR-215
  14. Sus scrofa (pig) ssc-miR-215
  15. Taeniopygia guttata (zebra finch) tgu-miR-215-5p
Publications