Macaca nemestrina (pig-tailed macaque) mne-miR-215 URS0000315B13_9545

• 21 nucleotides
• 2 databases (ENA, miRBase)
• Found in 15 other species
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

AUGACCUAUGAAUUGACAGAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

1. Alligator mississippiensis (American alligator) ami-miR-215-5p
2. Capra hircus chi-miR-215-5p
3. Chrysemys picta bellii Cpi-Mir-192-P1_5p (mature (guide))
4. Chrysemys picta cpi-miR-215-5p
5. Equus caballus (horse) eca-miR-215
6. Gallus gallus gga-miR-215-5p
7. Gorilla gorilla gorilla ggo-miR-215 (MIR215)
8. Gorilla gorilla (western gorilla) ggo-miR-215
9. Homo sapiens (human) hsa-miR-215-5p
10. Macaca mulatta (Rhesus monkey) mml-miR-215-5p
11. Ornithorhynchus anatinus (platypus) oan-miR-215-5p
12. Pan troglodytes ptr-miR-215
13. Pongo pygmaeus ppy-miR-215
14. Sus scrofa (pig) ssc-miR-215
15. Taeniopygia guttata (zebra finch) tgu-miR-215-5p

Download

• FASTA
• JSON