Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-215 URS0000315B13_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-215: ssc-mir-215 is a microRNA that has been found to be involved in various biological processes in pigs. It has been shown to competitively bind to other microRNAs such as ssc-miR-490-5p, ssc-miR-216, ssc-miR-874, and ssc-miR-184 [PMC6458635]. In different studies, ssc-mir-215 has been found to be both upregulated and downregulated in various tissues and conditions. For example, it was upregulated in infected intestinal tissues [PMC5326932] and in the lungs of Tongcheng pigs [PMC5381705]. On the other hand, it was downregulated in infected intestine samples [PMC5326932] and in Landraces' lungs [PMC5381705]. The expression levels of ssc-mir-215 were also found to be significantly different between different groups based on RT-qPCR results [PMC3832476]. It has been suggested that ssc-mir-215 may play a role in regulating epithelial cell differentiation [PMC5326932]. Additionally, it has been predicted to bind with multiple target genes involved in various biological processes such as NCEH1, CHRNA6, RORC, TPPP3, HSPB6, FRAS1, and TNNI1 [PMC7264268]. Overall, the expression of ssc-mir-215 appears to be influenced by different factors and may have diverse functions depending on the specific context.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUGACCUAUGAAUUGACAGAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Alligator mississippiensis (American alligator) ami-miR-215-5p
  2. Capra hircus chi-miR-215-5p
  3. Chrysemys picta bellii Cpi-Mir-192-P1_5p (mature (guide))
  4. Chrysemys picta cpi-miR-215-5p
  5. Equus caballus (horse) eca-miR-215
  6. Gallus gallus gga-miR-215-5p
  7. Gorilla gorilla gorilla ggo-miR-215 (MIR215)
  8. Gorilla gorilla (western gorilla) ggo-miR-215
  9. Homo sapiens (human) hsa-miR-215-5p
  10. Macaca mulatta (Rhesus monkey) mml-miR-215-5p
  11. Macaca nemestrina (pig-tailed macaque) mne-miR-215
  12. Ornithorhynchus anatinus (platypus) oan-miR-215-5p
  13. Pan troglodytes ptr-miR-215
  14. Pongo pygmaeus ppy-miR-215
  15. Taeniopygia guttata (zebra finch) tgu-miR-215-5p
Publications