v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-215-5p URS0000315B13_9606

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AUGACCUAUGAAUUGACAGAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Alligator mississippiensis (American alligator) ami-miR-215-5p
  2. Capra hircus chi-miR-215-5p
  3. Chrysemys picta bellii Cpi-Mir-192-P1_5p (mature (guide))
  4. Chrysemys picta cpi-miR-215-5p
  5. Equus caballus (horse) eca-miR-215
  6. Gallus gallus gga-miR-215-5p
  7. Gorilla gorilla gorilla ggo-miR-215 (MIR215)
  8. Gorilla gorilla (western gorilla) ggo-miR-215
  9. Macaca mulatta (Rhesus monkey) mml-miR-215-5p
  10. Macaca nemestrina (pig-tailed macaque) mne-miR-215
  11. Ornithorhynchus anatinus (platypus) oan-miR-215-5p
  12. Pan troglodytes ptr-miR-215
  13. Pongo pygmaeus ppy-miR-215
  14. Sus scrofa (pig) ssc-miR-215
  15. Taeniopygia guttata (zebra finch) tgu-miR-215-5p
 Publications