Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-215-5p URS0000315B13_9606

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Homo sapiens. Annotated by 7 databases (RefSeq, ENA, TarBase, GeneCards, miRBase, LncBase, MalaCards). Described in 47 papers. Homo sapiens (human) hsa-miR-215-5p sequence is a product of hsa-miR-215, 215, miR-215, hsa-miR-215-5p, miR-215-5p, mir-215, MIR215 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 2PP2A, AC7, ACAT, ACTB, ACTR2, ACVR2B, ADAMTS1, ADAMTS13, ADCY7, ADPRTL2.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AUGACCUAUGAAUUGACAGAC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 13 other species

    1. Alligator mississippiensis (American alligator) ami-miR-215-5p
    2. Capra hircus chi-miR-215-5p
    3. Chrysemys picta bellii (western painted turtle) Cpi-Mir-192-P2_5p (mature (guide))
    4. Chrysemys picta (Painted turtle) cpi-miR-215-5p
    5. Equus caballus (horse) eca-miR-215
    6. Gallus gallus (chicken) gga-miR-215-5p
    7. Gorilla gorilla (western gorilla) ggo-miR-215
    8. Macaca mulatta mml-miR-215-5p
    9. Macaca nemestrina (pig-tailed macaque) mne-miR-215
    10. Ornithorhynchus anatinus (platypus) oan-miR-215-5p
    11. Pan troglodytes (chimpanzee) ptr-miR-215
    12. Pongo pygmaeus ppy-miR-215
    13. Sus scrofa (pig) ssc-miR-215
    14. Taeniopygia guttata (zebra finch) tgu-miR-215-5p