Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-215-5p URS0000315B13_9031

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

gga-mir-215: Gga-mir-215 is a microRNA that has been studied in various contexts. In CD30hi cells, gga-mir-215 is increased, while in RSS chicken, it is one of the up-regulated miRNAs [PMC3472249] [PMC4444097]. However, there is a slight discrepancy between the qRT-PCR and miRNA-seq data for gga-mir-215 [PMC3327661]. In another study, gga-mir-215 was chosen as one of the DEMs to validate expression trends using qPCR [PMC8633681]. The expression of gga-mir-215 was found to be inversely related to its target gene ASL2 in different groups [PMC5203650]. The expression patterns of gga-miR-21, gga-miR-146b-5p, gga-miR-146b-3p, gga-miR-429, and gga-mir-215 were comparable to the sequencing results [PMC5203650]. Gga-mir-215 has also been found to induce the expression of C7 in a study investigating its target genes [PMC5203650]. Additionally, there were significant changes in the expression levels of gga-miR9.3p, ggammiR383 and ggamiR203 in different groups. GgammiR194 ggamiR138 ggammiRNA215 and ggamiRNA7 also exhibited significant changes between different groups [PMC5203650]. Overall, these studies highlight the involvement of ggammiRNA215 in various biological processes and its potential as a biomarker or therapeutic target.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUGACCUAUGAAUUGACAGAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Alligator mississippiensis (American alligator) ami-miR-215-5p
  2. Capra hircus chi-miR-215-5p
  3. Chrysemys picta bellii Cpi-Mir-192-P1_5p (mature (guide))
  4. Chrysemys picta cpi-miR-215-5p
  5. Equus caballus (horse) eca-miR-215
  6. Gorilla gorilla gorilla ggo-miR-215 (MIR215)
  7. Gorilla gorilla (western gorilla) ggo-miR-215
  8. Homo sapiens (human) hsa-miR-215-5p
  9. Macaca mulatta (Rhesus monkey) mml-miR-215-5p
  10. Macaca nemestrina (pig-tailed macaque) mne-miR-215
  11. Ornithorhynchus anatinus (platypus) oan-miR-215-5p
  12. Pan troglodytes ptr-miR-215
  13. Pongo pygmaeus ppy-miR-215
  14. Sus scrofa (pig) ssc-miR-215
  15. Taeniopygia guttata (zebra finch) tgu-miR-215-5p
Publications