Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-130a URS0000315338_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-130a: bta-mir-130a is a microRNA that has been found to affect cellular triacylglyceride synthesis in bovine mammary epithelial cells by regulating PPAR-γ, fatty acid storage, and glucose metabolism [PMC6164576]. It has also been linked to milk fat synthesis [PMC6164576]. The designation of bta-mir-130a is used without the 3p/5p specifications in the literature [PMC9192975]. The expression pattern of bta-mir-130a has been validated at different growth stages using qRT-PCR [PMC8727870]. It is one of the most significant differentially expressed miRNAs and targets the 3'UTR of several genes with high confidence [PMC9437019]. In response to Gram-positive S. uberis, bta-mir-130a is down-regulated and has known roles in immunity and infection in other species [PMC3589390]. It also regulates the biosynthesis of bovine milk fat by targeting peroxisome proliferator-activated receptor gamma [PMC6699390]. In addition, bta-mir-130a is involved in inflammation and disease processes [PMC9445238]. qPCR validation confirms the expression pattern of bta-mir-130a using reference smallRNAs such as RNU6, SNORD95, and miScript Primer Assay [PMC6965648]. Overexpression of bta-mir-130a reduces triglyceride concentration in epithelial cells and interferes with lipid droplet formation. It also affects gene expression related to differentiation and lipid metabolism by down-regulating genes such as C/EBPα, C/EBPβ, FABP4, LPIN1, LPL while increasing SREBP1 expression. The inhibition of bta-mir-130a decreases SREBP1 expression [PMC7140828].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGUGCAAUGUUAAAAGGGCAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 40 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-130-P1b_3p (mature (guide))
  2. Anolis carolinensis Aca-Mir-130-P1b_3p (mature (guide))
  3. Canis lupus familiaris (dog) cfa-miR-130a
  4. Capra hircus miR-130a
  5. Cavia porcellus cpo-miR-130a-3p
  6. Cervus elaphus cel-miR-130a
  7. Chrysemys picta bellii Cpi-Mir-130-P1b_3p (mature (guide))
  8. Columba livia (rock pigeon) cli-miR-130a-3p
  9. Cricetulus griseus (Chinese hamster) cgr-miR-130a-3p
  10. Cyprinus carpio (common carp) ccr-miR-130a
  11. Danio rerio dre-miR-130a
  12. Dasypus novemcinctus dno-miR-130a-3p
  13. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-130-P1c_3p (mature (guide))
  14. Equus caballus (horse) eca-miR-130a
  15. Gallus gallus gga-miR-130c-3p
  16. Gekko japonicus Gja-Mir-130-P1b_3p (mature (guide))
  17. Homo sapiens (human) hsa-miR-130a-3p
  18. Latimeria chalumnae (coelacanth) Lch-Mir-130-P1b_3p (mature (guide))
  19. Lepisosteus oculatus (spotted gar) Loc-Mir-130-P1b_3p (mature (co-guide))
  20. Macaca mulatta (Rhesus monkey) Mml-Mir-130-P1c_3p (mature (guide))
  21. Microcaecilia unicolor Mun-Mir-130-P1b_3p (mature (guide))
  22. Monodelphis domestica mdo-miR-130c-3p
  23. Mus musculus (house mouse) mmu-miR-130a-3p
  24. Ophiophagus hannah (king cobra) oha-miR-130b-3p
  25. Ornithorhynchus anatinus (platypus) oan-miR-130b-3p
  26. Otolemur garnettii oga-miR-130a
  27. Ovis aries (sheep) miscellaneous RNA
  28. Pan troglodytes ptr-miR-130a
  29. Pongo pygmaeus ppy-miR-130a
  30. Pteropus alecto (black flying fox) pal-miR-130-3p
  31. Python bivittatus (Burmese python) pbv-miR-130d-3p
  32. Rattus norvegicus rno-miR-130a-3p
  33. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-130-P1b_3p (mature (guide))
  34. Sphenodon punctatus (tuatara) Spt-Mir-130-P1b_3p (mature (guide))
  35. Sus scrofa (pig) ssc-miR-130a
  36. Taeniopygia guttata (zebra finch) tgu-miR-130c-3p
  37. Tor tambroides miR-130a
  38. Tupaia chinensis (Chinese tree shrew) tch-miR-130a-3p
  39. Xenopus laevis Xla-Mir-130-P1b3_3p (mature (guide))
  40. Xenopus tropicalis xtr-miR-130a
Publications